EMAIL THIS PAGE TO A FRIEND

ZNF486

zinc finger protein 486

Synonyms: KRBO2
Species: Human ZNF486(90649)
UniProtKB ID: Q96H40, Q0VG00
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301699 Anti-ZNF486 affinity isolated antibody human
immunohistochemistry pricing
AV51696 Anti-ZNF486 (AB1) antibody produced in rabbit affinity isolated antibody zebrafish, rabbit, canine, bovine, human, mouse, rat, horse
western blot pricing
AV51697 Anti-ZNF486 (AB2) antibody produced in rabbit affinity isolated antibody canine, human, rabbit, bovine, rat, mouse, horse
western blot pricing
SAB1408174 Anti-ZNF486 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371152 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112231 MISSION® esiRNA esiRNA human ZNF486 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052852 Rosetta Predictions human pricing
XM_371152 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361540 predicted 802
2 SASI_Hs02_00361541 predicted 1214
3 SASI_Hs02_00361542 predicted 1055
4 SASI_Hs02_00361543 predicted 801
5 SASI_Hs02_00361544 predicted 1053
6 SASI_Hs02_00361545 predicted 790
7 SASI_Hs02_00361546 predicted 1294
8 SASI_Hs02_00361547 predicted 81
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281886 predicted 1033
2 SASI_Hs01_00281887 predicted 1016
3 SASI_Hs01_00281888 predicted 1008
4 SASI_Hs01_00281889 predicted 1525
5 SASI_Hs01_00281890 predicted 1515
6 SASI_Hs01_00281891 predicted 303
7 SASI_Hs01_00281892 predicted 1529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371152
ZNF486 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 486
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371152.1-1125s1c1
Sequence:CCGGCCTTAGTAAACATGAGAAGATCTCGAGATCTTCTCATGTTTACTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371152.1-1357s1c1
Sequence:CCGGGCGTATACTACATCCTCAAATCTCGAGATTTGAGGATGTAGTATACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371152.1-270s1c1
Sequence:CCGGCCTTGGTATTATTGTCTCTAACTCGAGTTAGAGACAATAATACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371152.1-1292s1c1
Sequence:CCGGGCCTCCATAAACATAGGAGAACTCGAGTTCTCCTATGTTTATGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371152.1-1151s1c1
Sequence:CCGGCGGGAGAGAAACCCTACAAATCTCGAGATTTGTAGGGTTTCTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371152
ZNF486 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 486
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371152.1-1125s1c1
Sequence:CCGGCCTTAGTAAACATGAGAAGATCTCGAGATCTTCTCATGTTTACTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371152.1-1357s1c1
Sequence:CCGGGCGTATACTACATCCTCAAATCTCGAGATTTGAGGATGTAGTATACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371152.1-270s1c1
Sequence:CCGGCCTTGGTATTATTGTCTCTAACTCGAGTTAGAGACAATAATACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371152.1-1292s1c1
Sequence:CCGGGCCTCCATAAACATAGGAGAACTCGAGTTCTCCTATGTTTATGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371152.1-1151s1c1
Sequence:CCGGCGGGAGAGAAACCCTACAAATCTCGAGATTTGTAGGGTTTCTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371152
ZNF486 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 486
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371152.1-1125s1c1
Sequence:CCGGCCTTAGTAAACATGAGAAGATCTCGAGATCTTCTCATGTTTACTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371152.1-1357s1c1
Sequence:CCGGGCGTATACTACATCCTCAAATCTCGAGATTTGAGGATGTAGTATACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371152.1-270s1c1
Sequence:CCGGCCTTGGTATTATTGTCTCTAACTCGAGTTAGAGACAATAATACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371152.1-1292s1c1
Sequence:CCGGGCCTCCATAAACATAGGAGAACTCGAGTTCTCCTATGTTTATGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371152.1-1151s1c1
Sequence:CCGGCGGGAGAGAAACCCTACAAATCTCGAGATTTGTAGGGTTTCTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks