EMAIL THIS PAGE TO A FRIEND

ZNF488

zinc finger protein 488

UniProtKB ID: Q96MN9
Gene ID:
chicken(428956) zinc finger protein 488
dog(489083) zinc finger protein 488
domestic cat(101090802) zinc finger protein 488
cow(523833) zinc finger protein 488
sheep(101114928) zinc finger protein 488
domestic guinea pig(100721690) zinc finger protein 488
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153034 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073791 MISSION® esiRNA esiRNA human ZNF488 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153034 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102435 predicted 1034
2 SASI_Hs01_00102436 predicted 1178
3 SASI_Hs01_00102437 predicted 731
4 SASI_Hs01_00102438 predicted 636
5 SASI_Hs01_00102439 predicted 644
6 SASI_Hs01_00102440 predicted 996
7 SASI_Hs01_00102441 predicted 234
8 SASI_Hs01_00102442 predicted 680
9 SASI_Hs01_00102443 predicted 672
10 SASI_Hs01_00102444 predicted 779
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153034
ZNF488 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 488
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153034.2-994s1c1
Sequence:CCGGGCAAAGTGCAACCTGTCCTTTCTCGAGAAAGGACAGGTTGCACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153034.2-632s1c1
Sequence:CCGGGTGAGCAAAGAAGCGCCTTTACTCGAGTAAAGGCGCTTCTTTGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153034.2-623s1c1
Sequence:CCGGGAGCACGAAGTGAGCAAAGAACTCGAGTTCTTTGCTCACTTCGTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153034.2-1164s1c1
Sequence:CCGGGCACATGACTTCTCACAGCTACTCGAGTAGCTGTGAGAAGTCATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153034.2-1484s21c1
Sequence:CCGGGATTCGAATCTGGGCTCTTTCCTCGAGGAAAGAGCCCAGATTCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153034.2-1520s21c1
Sequence:CCGGCCCTGGACAAAGAGCTTTAACCTCGAGGTTAAAGCTCTTTGTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153034.2-1309s21c1
Sequence:CCGGATAAACAGCTCAGGCATAATTCTCGAGAATTATGCCTGAGCTGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153034
ZNF488 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 488
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153034.2-994s1c1
Sequence:CCGGGCAAAGTGCAACCTGTCCTTTCTCGAGAAAGGACAGGTTGCACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153034.2-632s1c1
Sequence:CCGGGTGAGCAAAGAAGCGCCTTTACTCGAGTAAAGGCGCTTCTTTGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153034.2-623s1c1
Sequence:CCGGGAGCACGAAGTGAGCAAAGAACTCGAGTTCTTTGCTCACTTCGTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153034.2-1164s1c1
Sequence:CCGGGCACATGACTTCTCACAGCTACTCGAGTAGCTGTGAGAAGTCATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153034.2-1484s21c1
Sequence:CCGGGATTCGAATCTGGGCTCTTTCCTCGAGGAAAGAGCCCAGATTCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153034.2-1520s21c1
Sequence:CCGGCCCTGGACAAAGAGCTTTAACCTCGAGGTTAAAGCTCTTTGTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153034.2-1309s21c1
Sequence:CCGGATAAACAGCTCAGGCATAATTCTCGAGAATTATGCCTGAGCTGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153034
ZNF488 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 488
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153034.2-994s1c1
Sequence:CCGGGCAAAGTGCAACCTGTCCTTTCTCGAGAAAGGACAGGTTGCACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153034.2-632s1c1
Sequence:CCGGGTGAGCAAAGAAGCGCCTTTACTCGAGTAAAGGCGCTTCTTTGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153034.2-623s1c1
Sequence:CCGGGAGCACGAAGTGAGCAAAGAACTCGAGTTCTTTGCTCACTTCGTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153034.2-1164s1c1
Sequence:CCGGGCACATGACTTCTCACAGCTACTCGAGTAGCTGTGAGAAGTCATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153034.2-1484s21c1
Sequence:CCGGGATTCGAATCTGGGCTCTTTCCTCGAGGAAAGAGCCCAGATTCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153034.2-1520s21c1
Sequence:CCGGCCCTGGACAAAGAGCTTTAACCTCGAGGTTAAAGCTCTTTGTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153034.2-1309s21c1
Sequence:CCGGATAAACAGCTCAGGCATAATTCTCGAGAATTATGCCTGAGCTGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks