EMAIL THIS PAGE TO A FRIEND

ZNF48

zinc finger protein 48

Synonyms: ZNF553
UniProtKB ID: Q96MX3, Q15920, Q4G0R3, Q69YP3, Q96IL9
Gene ID:
dog(489901) zinc finger protein 48
domestic cat(101094559) zinc finger protein 48
domestic guinea pig(100712873) zinc finger protein 48
naked mole-rat(101721994) zinc finger protein 48
cow(512477) zinc finger protein 48
sheep(101121481) zinc finger protein 48
Goat(100861031) zinc finger protein 48
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA023806 Anti-ZNF48 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152652 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051961 MISSION® esiRNA esiRNA human ZNF553 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152652 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056575 predicted 720
2 SASI_Hs01_00056576 predicted 889
3 SASI_Hs01_00056577 predicted 1302
4 SASI_Hs01_00056579 predicted 1499
5 SASI_Hs01_00056580 predicted 892
6 SASI_Hs01_00056581 predicted 282
7 SASI_Hs01_00056582 predicted 214
8 SASI_Hs01_00056583 predicted 743
9 SASI_Hs01_00056584 predicted 1136
10 SASI_Hs02_00366544 predicted 229
11 SASI_Hs01_00056578 predicted 302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152652
VALIDATED
ZNF48 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 48
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152652.1-142s21c1
Sequence:CCGGTAGGGAGTGAGAACGTGATTTCTCGAGAAATCACGTTCTCACTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152652.1-867s21c1
Sequence:CCGGGCCCAGGACAAGCCATATATCCTCGAGGATATATGGCTTGTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_152652.1-167s21c1
Sequence:CCGGGCCGAATGAGTTTGAACATACCTCGAGGTATGTTCAAACTCATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152652.1-511s21c1
Sequence:CCGGATAGCTCTGCCCGGATCAAACCTCGAGGTTTGATCCGGGCAGAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152652.1-2004s1c1
Sequence:CCGGAGGGAGAAGGAAGGGAAGAAACTCGAGTTTCTTCCCTTCCTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_152652.1-231s1c1
Sequence:CCGGCCAGATCATGAAGTAGGAAATCTCGAGATTTCCTACTTCATGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152652.1-229s1c1
Sequence:CCGGCTCCAGATCATGAAGTAGGAACTCGAGTTCCTACTTCATGATCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152652.1-666s1c1
Sequence:CCGGCTGAGTTCTGACCTGGTGAAACTCGAGTTTCACCAGGTCAGAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_152652.1-165s1c1
Sequence:CCGGCAGCCGAATGAGTTTGAACATCTCGAGATGTTCAAACTCATTCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152652
VALIDATED
ZNF48 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 48
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152652.1-142s21c1
Sequence:CCGGTAGGGAGTGAGAACGTGATTTCTCGAGAAATCACGTTCTCACTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152652.1-867s21c1
Sequence:CCGGGCCCAGGACAAGCCATATATCCTCGAGGATATATGGCTTGTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_152652.1-167s21c1
Sequence:CCGGGCCGAATGAGTTTGAACATACCTCGAGGTATGTTCAAACTCATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152652.1-511s21c1
Sequence:CCGGATAGCTCTGCCCGGATCAAACCTCGAGGTTTGATCCGGGCAGAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152652.1-2004s1c1
Sequence:CCGGAGGGAGAAGGAAGGGAAGAAACTCGAGTTTCTTCCCTTCCTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_152652.1-231s1c1
Sequence:CCGGCCAGATCATGAAGTAGGAAATCTCGAGATTTCCTACTTCATGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152652.1-229s1c1
Sequence:CCGGCTCCAGATCATGAAGTAGGAACTCGAGTTCCTACTTCATGATCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152652.1-666s1c1
Sequence:CCGGCTGAGTTCTGACCTGGTGAAACTCGAGTTTCACCAGGTCAGAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_152652.1-165s1c1
Sequence:CCGGCAGCCGAATGAGTTTGAACATCTCGAGATGTTCAAACTCATTCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152652
VALIDATED
ZNF48 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 48
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152652.1-142s21c1
Sequence:CCGGTAGGGAGTGAGAACGTGATTTCTCGAGAAATCACGTTCTCACTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152652.1-867s21c1
Sequence:CCGGGCCCAGGACAAGCCATATATCCTCGAGGATATATGGCTTGTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_152652.1-167s21c1
Sequence:CCGGGCCGAATGAGTTTGAACATACCTCGAGGTATGTTCAAACTCATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152652.1-511s21c1
Sequence:CCGGATAGCTCTGCCCGGATCAAACCTCGAGGTTTGATCCGGGCAGAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152652.1-2004s1c1
Sequence:CCGGAGGGAGAAGGAAGGGAAGAAACTCGAGTTTCTTCCCTTCCTTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_152652.1-231s1c1
Sequence:CCGGCCAGATCATGAAGTAGGAAATCTCGAGATTTCCTACTTCATGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152652.1-229s1c1
Sequence:CCGGCTCCAGATCATGAAGTAGGAACTCGAGTTCCTACTTCATGATCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152652.1-666s1c1
Sequence:CCGGCTGAGTTCTGACCTGGTGAAACTCGAGTTTCACCAGGTCAGAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_152652.1-165s1c1
Sequence:CCGGCAGCCGAATGAGTTTGAACATCTCGAGATGTTCAAACTCATTCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks