EMAIL THIS PAGE TO A FRIEND

ZNF490

zinc finger protein 490

Species: Human ZNF490(57474)
UniProtKB ID: Q9ULM2
Gene ID:
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020714 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020714 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020714 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102931 MISSION® esiRNA esiRNA human AC092329.3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020714 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203501 predicted 463
2 SASI_Hs01_00203503 predicted 251
3 SASI_Hs01_00203504 predicted 1695
4 SASI_Hs01_00203505 predicted 210
5 SASI_Hs01_00203507 predicted 650
6 SASI_Hs01_00203508 predicted 1551
7 SASI_Hs01_00203509 predicted 1665
8 SASI_Hs02_00353729 predicted 1614
9 SASI_Hs01_00203510 predicted 1226
10 SASI_Hs02_00353730 predicted 1060
11 SASI_Hs01_00203502 predicted 630
12 SASI_Hs01_00203506 predicted 554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020714
VALIDATED
ZNF490 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 490
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020714.1-553s21c1
Sequence:CCGGGGAAACTCCTACTGGATTAAACTCGAGTTTAATCCAGTAGGAGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020714.1-4970s21c1
Sequence:CCGGGTCTGTGTGAGTCCTAATATTCTCGAGAATATTAGGACTCACACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020714.1-1180s21c1
Sequence:CCGGCACCGGAGTTCAACCTTATACCTCGAGGTATAAGGTTGAACTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020714.1-791s21c1
Sequence:CCGGTGTGGCAAAGCCTTCGCATTTCTCGAGAAATGCGAAGGCTTTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020714.1-609s21c1
Sequence:CCGGTGCATCAGGTCTCCCTTAATACTCGAGTATTAAGGGAGACCTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020714.1-3258s1c1
Sequence:CCGGGCCTTCTTAAATGTAAGCAATCTCGAGATTGCTTACATTTAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020714.1-252s1c1
Sequence:CCGGGACAAAGCATCAAGACTCAAACTCGAGTTTGAGTCTTGATGCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_020714.1-550s1c1
Sequence:CCGGCCTGGAAACTCCTACTGGATTCTCGAGAATCCAGTAGGAGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020714.1-1064s1c1
Sequence:CCGGCCCACGTACTTACGGAGTCATCTCGAGATGACTCCGTAAGTACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020714.1-732s1c1
Sequence:CCGGCCAGTATTCGAACCCATGAAACTCGAGTTTCATGGGTTCGAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020714
VALIDATED
ZNF490 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 490
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020714.1-553s21c1
Sequence:CCGGGGAAACTCCTACTGGATTAAACTCGAGTTTAATCCAGTAGGAGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020714.1-4970s21c1
Sequence:CCGGGTCTGTGTGAGTCCTAATATTCTCGAGAATATTAGGACTCACACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020714.1-1180s21c1
Sequence:CCGGCACCGGAGTTCAACCTTATACCTCGAGGTATAAGGTTGAACTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020714.1-791s21c1
Sequence:CCGGTGTGGCAAAGCCTTCGCATTTCTCGAGAAATGCGAAGGCTTTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020714.1-609s21c1
Sequence:CCGGTGCATCAGGTCTCCCTTAATACTCGAGTATTAAGGGAGACCTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020714.1-3258s1c1
Sequence:CCGGGCCTTCTTAAATGTAAGCAATCTCGAGATTGCTTACATTTAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020714.1-252s1c1
Sequence:CCGGGACAAAGCATCAAGACTCAAACTCGAGTTTGAGTCTTGATGCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_020714.1-550s1c1
Sequence:CCGGCCTGGAAACTCCTACTGGATTCTCGAGAATCCAGTAGGAGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020714.1-1064s1c1
Sequence:CCGGCCCACGTACTTACGGAGTCATCTCGAGATGACTCCGTAAGTACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020714.1-732s1c1
Sequence:CCGGCCAGTATTCGAACCCATGAAACTCGAGTTTCATGGGTTCGAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020714
VALIDATED
ZNF490 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 490
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020714.1-553s21c1
Sequence:CCGGGGAAACTCCTACTGGATTAAACTCGAGTTTAATCCAGTAGGAGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020714.1-4970s21c1
Sequence:CCGGGTCTGTGTGAGTCCTAATATTCTCGAGAATATTAGGACTCACACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020714.1-1180s21c1
Sequence:CCGGCACCGGAGTTCAACCTTATACCTCGAGGTATAAGGTTGAACTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020714.1-791s21c1
Sequence:CCGGTGTGGCAAAGCCTTCGCATTTCTCGAGAAATGCGAAGGCTTTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020714.1-609s21c1
Sequence:CCGGTGCATCAGGTCTCCCTTAATACTCGAGTATTAAGGGAGACCTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020714.1-3258s1c1
Sequence:CCGGGCCTTCTTAAATGTAAGCAATCTCGAGATTGCTTACATTTAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020714.1-252s1c1
Sequence:CCGGGACAAAGCATCAAGACTCAAACTCGAGTTTGAGTCTTGATGCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_020714.1-550s1c1
Sequence:CCGGCCTGGAAACTCCTACTGGATTCTCGAGAATCCAGTAGGAGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020714.1-1064s1c1
Sequence:CCGGCCCACGTACTTACGGAGTCATCTCGAGATGACTCCGTAAGTACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020714.1-732s1c1
Sequence:CCGGCCAGTATTCGAACCCATGAAACTCGAGTTTCATGGGTTCGAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks