EMAIL THIS PAGE TO A FRIEND

ZNF491

zinc finger protein 491

Species: Human ZNF491(126069)
UniProtKB ID: Q8N8L2, Q3MJ35, Q8NAT8
Gene ID:
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36172 Anti-ZNF491 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2102891 Anti-ZNF491 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152356 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034251 MISSION® esiRNA esiRNA human ZNF491 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152356 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147202 predicted 634
2 SASI_Hs01_00147203 predicted 1034
3 SASI_Hs01_00147204 predicted 1203
4 SASI_Hs01_00147205 predicted 1005
5 SASI_Hs01_00147206 predicted 634
6 SASI_Hs01_00147207 predicted 410
7 SASI_Hs01_00147208 predicted 883
8 SASI_Hs01_00147209 predicted 425
9 SASI_Hs01_00147210 predicted 286
10 SASI_Hs01_00147211 predicted 1203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152356
ZNF491 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 491
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152356.2-463s1c1
Sequence:CCGGCCAACCACATAAGTGTCAGAACTCGAGTTCTGACACTTATGTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152356.2-1203s1c1
Sequence:CCGGCTTGTTCCACTTCGTTTCAATCTCGAGATTGAAACGAAGTGGAACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152356.2-1024s1c1
Sequence:CCGGGAAAGCATTATCTCGCCTTATCTCGAGATAAGGCGAGATAATGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152356.2-1447s1c1
Sequence:CCGGAGCCTTCACTTGTTCCATATACTCGAGTATATGGAACAAGTGAAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152356.2-414s1c1
Sequence:CCGGTCATGGGATATTCATCCTTTACTCGAGTAAAGGATGAATATCCCATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152356.3-2026s21c1
Sequence:CCGGGTACATACCAGAGAGATAATGCTCGAGCATTATCTCTCTGGTATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152356.3-628s21c1
Sequence:CCGGCCTGCAAGCATTCGAAGATATCTCGAGATATCTTCGAATGCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152356
ZNF491 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 491
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152356.2-463s1c1
Sequence:CCGGCCAACCACATAAGTGTCAGAACTCGAGTTCTGACACTTATGTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152356.2-1203s1c1
Sequence:CCGGCTTGTTCCACTTCGTTTCAATCTCGAGATTGAAACGAAGTGGAACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152356.2-1024s1c1
Sequence:CCGGGAAAGCATTATCTCGCCTTATCTCGAGATAAGGCGAGATAATGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152356.2-1447s1c1
Sequence:CCGGAGCCTTCACTTGTTCCATATACTCGAGTATATGGAACAAGTGAAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152356.2-414s1c1
Sequence:CCGGTCATGGGATATTCATCCTTTACTCGAGTAAAGGATGAATATCCCATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152356.3-2026s21c1
Sequence:CCGGGTACATACCAGAGAGATAATGCTCGAGCATTATCTCTCTGGTATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152356.3-628s21c1
Sequence:CCGGCCTGCAAGCATTCGAAGATATCTCGAGATATCTTCGAATGCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152356
ZNF491 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 491
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152356.2-463s1c1
Sequence:CCGGCCAACCACATAAGTGTCAGAACTCGAGTTCTGACACTTATGTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152356.2-1203s1c1
Sequence:CCGGCTTGTTCCACTTCGTTTCAATCTCGAGATTGAAACGAAGTGGAACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152356.2-1024s1c1
Sequence:CCGGGAAAGCATTATCTCGCCTTATCTCGAGATAAGGCGAGATAATGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152356.2-1447s1c1
Sequence:CCGGAGCCTTCACTTGTTCCATATACTCGAGTATATGGAACAAGTGAAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152356.2-414s1c1
Sequence:CCGGTCATGGGATATTCATCCTTTACTCGAGTAAAGGATGAATATCCCATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152356.3-2026s21c1
Sequence:CCGGGTACATACCAGAGAGATAATGCTCGAGCATTATCTCTCTGGTATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152356.3-628s21c1
Sequence:CCGGCCTGCAAGCATTCGAAGATATCTCGAGATATCTTCGAATGCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks