EMAIL THIS PAGE TO A FRIEND

ZNF492

zinc finger protein 492

Synonyms: ZNF115
Species: Human ZNF492(57615)
UniProtKB ID: Q9P255, Q08EI7, Q08EI8
Gene ID:
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302383 ANTI-ZNF492 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1411902 ANTI-ZNF492 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020855 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020855 Rosetta Predictions human pricing
XM_047550 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354118 predicted 1814
2 SASI_Hs02_00354119 predicted 1667
3 SASI_Hs02_00354120 predicted 1804
4 SASI_Hs02_00354121 predicted 1666
5 SASI_Hs02_00354122 predicted 1666
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_047550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299423 predicted 2618
2 SASI_Hs01_00299424 predicted 1103
3 SASI_Hs01_00299425 predicted 682
4 SASI_Hs01_00299426 predicted 2270
5 SASI_Hs01_00299427 predicted 2188
6 SASI_Hs01_00299428 predicted 1694
7 SASI_Hs01_00299429 predicted 1106
8 SASI_Hs01_00299430 predicted 2604
9 SASI_Hs01_00299431 predicted 2617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020855
ZNF492 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 492
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020855.1-2569s21c1
Sequence:CCGGACTCAAATTACTTCGTGTTAACTCGAGTTAACACGAAGTAATTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020855.1-3332s21c1
Sequence:CCGGTTCAATCAAGTCACATTATTCCTCGAGGAATAATGTGACTTGATTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020855.1-3910s21c1
Sequence:CCGGTGATAAGAGGCATACAATATGCTCGAGCATATTGTATGCCTCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020855.1-2243s21c1
Sequence:CCGGATTCCAGAGAGTTCATATTAACTCGAGTTAATATGAACTCTCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020855.1-3752s21c1
Sequence:CCGGACTAACATCTGTAGTACTAATCTCGAGATTAGTACTACAGATGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020855
ZNF492 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 492
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020855.1-2569s21c1
Sequence:CCGGACTCAAATTACTTCGTGTTAACTCGAGTTAACACGAAGTAATTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020855.1-3332s21c1
Sequence:CCGGTTCAATCAAGTCACATTATTCCTCGAGGAATAATGTGACTTGATTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020855.1-3910s21c1
Sequence:CCGGTGATAAGAGGCATACAATATGCTCGAGCATATTGTATGCCTCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020855.1-2243s21c1
Sequence:CCGGATTCCAGAGAGTTCATATTAACTCGAGTTAATATGAACTCTCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020855.1-3752s21c1
Sequence:CCGGACTAACATCTGTAGTACTAATCTCGAGATTAGTACTACAGATGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020855
ZNF492 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 492
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020855.1-2569s21c1
Sequence:CCGGACTCAAATTACTTCGTGTTAACTCGAGTTAACACGAAGTAATTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020855.1-3332s21c1
Sequence:CCGGTTCAATCAAGTCACATTATTCCTCGAGGAATAATGTGACTTGATTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020855.1-3910s21c1
Sequence:CCGGTGATAAGAGGCATACAATATGCTCGAGCATATTGTATGCCTCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020855.1-2243s21c1
Sequence:CCGGATTCCAGAGAGTTCATATTAACTCGAGTTAATATGAACTCTCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020855.1-3752s21c1
Sequence:CCGGACTAACATCTGTAGTACTAATCTCGAGATTAGTACTACAGATGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks