EMAIL THIS PAGE TO A FRIEND

ZNF493

zinc finger protein 493

Species: Human ZNF493(284443)
Gene ID:
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301998 ANTI-ZNF493 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145326 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175910 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001076678 Rosetta Predictions human pricing
NM_145326 Rosetta Predictions human pricing
NM_175910 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311964 predicted 2051
2 SASI_Hs02_00311965 predicted 2452
3 SASI_Hs02_00311966 predicted 2284
4 SASI_Hs02_00311967 predicted 1936
5 SASI_Hs02_00311968 predicted 938
6 SASI_Hs02_00311969 predicted 1939
7 SASI_Hs02_00311970 predicted 2045
8 SASI_Hs02_00311971 predicted 2492
9 SASI_Hs02_00311972 predicted 2185
10 SASI_Hs02_00311973 predicted 2460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233936 predicted 1419
2 SASI_Hs01_00233937 predicted 930
3 SASI_Hs01_00233938 predicted 1470
4 SASI_Hs01_00233939 predicted 910
5 SASI_Hs01_00233940 predicted 1603
6 SASI_Hs01_00233941 predicted 1423
7 SASI_Hs01_00233942 predicted 1418
8 SASI_Hs01_00233943 predicted 943
9 SASI_Hs01_00233944 predicted 1533
10 SASI_Hs01_00233945 predicted 1601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209901 predicted 1825
2 SASI_Hs01_00209902 predicted 2232
3 SASI_Hs01_00209903 predicted 2059
4 SASI_Hs01_00209904 predicted 1711
5 SASI_Hs01_00209905 predicted 720
6 SASI_Hs01_00209906 predicted 1723
7 SASI_Hs01_00209907 predicted 1822
8 SASI_Hs01_00209908 predicted 2275
9 SASI_Hs01_00209909 predicted 1961
10 SASI_Hs02_00369170 predicted 2233
11 SASI_Hs01_00209900 predicted 931
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145326
ZNF493 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 493
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145326.1-307s1c1
Sequence:CCGGGAAGGGACACAGTACGGTAGTCTCGAGACTACCGTACTGTGTCCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145326.1-205s1c1
Sequence:CCGGGATGTTAGAGAACTACAGAAACTCGAGTTTCTGTAGTTCTCTAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145326.1-227s1c1
Sequence:CCGGCTGGTCTTCTTGGCAGGTATTCTCGAGAATACCTGCCAAGAAGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145326.1-182s1c1
Sequence:CCGGCAGCAGGATTTGTATAGGAAACTCGAGTTTCCTATACAAATCCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145326.1-115s1c1
Sequence:CCGGGCCGTTGACATTTAGGGATGTCTCGAGACATCCCTAAATGTCAACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145326
ZNF493 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 493
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145326.1-307s1c1
Sequence:CCGGGAAGGGACACAGTACGGTAGTCTCGAGACTACCGTACTGTGTCCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145326.1-205s1c1
Sequence:CCGGGATGTTAGAGAACTACAGAAACTCGAGTTTCTGTAGTTCTCTAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145326.1-227s1c1
Sequence:CCGGCTGGTCTTCTTGGCAGGTATTCTCGAGAATACCTGCCAAGAAGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145326.1-182s1c1
Sequence:CCGGCAGCAGGATTTGTATAGGAAACTCGAGTTTCCTATACAAATCCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145326.1-115s1c1
Sequence:CCGGGCCGTTGACATTTAGGGATGTCTCGAGACATCCCTAAATGTCAACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145326
ZNF493 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 493
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145326.1-307s1c1
Sequence:CCGGGAAGGGACACAGTACGGTAGTCTCGAGACTACCGTACTGTGTCCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145326.1-205s1c1
Sequence:CCGGGATGTTAGAGAACTACAGAAACTCGAGTTTCTGTAGTTCTCTAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145326.1-227s1c1
Sequence:CCGGCTGGTCTTCTTGGCAGGTATTCTCGAGAATACCTGCCAAGAAGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145326.1-182s1c1
Sequence:CCGGCAGCAGGATTTGTATAGGAAACTCGAGTTTCCTATACAAATCCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145326.1-115s1c1
Sequence:CCGGGCCGTTGACATTTAGGGATGTCTCGAGACATCCCTAAATGTCAACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175910
ZNF493 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 493
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000017587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175910.4-802s1c1
Sequence:CCGGCCCTTATTGGACATAAGATAACTCGAGTTATCTTATGTCCAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175910.4-1306s1c1
Sequence:CCGGCCCTTACTAAACATAGGATAACTCGAGTTATCCTATGTTTAGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175910.4-1249s1c1
Sequence:CCGGCAGAAGAGAAACCCTACAAATCTCGAGATTTGTAGGGTTTCTCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175910.4-1815s1c1
Sequence:CCGGGCTGGGCACAAGCAAATTCATCTCGAGATGAATTTGCTTGTGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175910
ZNF493 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 493
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000017587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175910.4-802s1c1
Sequence:CCGGCCCTTATTGGACATAAGATAACTCGAGTTATCTTATGTCCAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175910.4-1306s1c1
Sequence:CCGGCCCTTACTAAACATAGGATAACTCGAGTTATCCTATGTTTAGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175910.4-1249s1c1
Sequence:CCGGCAGAAGAGAAACCCTACAAATCTCGAGATTTGTAGGGTTTCTCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175910.4-1815s1c1
Sequence:CCGGGCTGGGCACAAGCAAATTCATCTCGAGATGAATTTGCTTGTGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175910
ZNF493 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 493
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000017587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175910.4-802s1c1
Sequence:CCGGCCCTTATTGGACATAAGATAACTCGAGTTATCTTATGTCCAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175910.4-1306s1c1
Sequence:CCGGCCCTTACTAAACATAGGATAACTCGAGTTATCCTATGTTTAGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175910.4-1249s1c1
Sequence:CCGGCAGAAGAGAAACCCTACAAATCTCGAGATTTGTAGGGTTTCTCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175910.4-1815s1c1
Sequence:CCGGGCTGGGCACAAGCAAATTCATCTCGAGATGAATTTGCTTGTGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks