EMAIL THIS PAGE TO A FRIEND

ZNF496

zinc finger protein 496

Synonyms: NIZP1 ZFP496 ZKSCAN17 ZSCAN49
UniProtKB ID: Q96IT1, Q8TBS2
Gene ID:
dog(490575) zinc finger protein 496
domestic cat(101093076) zinc finger protein 496
Horse(100065790) zinc finger protein 496
Domestic Rabbit(100355168) zinc finger protein 496
naked mole-rat(101712884) zinc finger protein 496
cow(526480) zinc finger protein 496
sheep(100628316) zinc finger protein 496
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032752 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032752 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032752 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032752 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131227 predicted 1314
2 SASI_Hs01_00131228 predicted 2135
3 SASI_Hs01_00131229 predicted 1676
4 SASI_Hs01_00131230 predicted 1243
5 SASI_Hs01_00131231 predicted 1333
6 SASI_Hs01_00131233 predicted 1122
7 SASI_Hs01_00131234 predicted 972
8 SASI_Hs01_00131235 predicted 1670
9 SASI_Hs01_00131236 predicted 1124
10 SASI_Hs02_00360298 predicted 1191
11 SASI_Hs01_00131232 predicted 2015
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032752
VALIDATED
ZNF496 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 496
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032752.1-1503s1c1
Sequence:CCGGCCTGGATGAAGAAGTGACCATCTCGAGATGGTCACTTCTTCATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032752.1-1126s1c1
Sequence:CCGGTCTCCATTCAAGGACATGATTCTCGAGAATCATGTCCTTGAATGGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032752.1-2271s21c1
Sequence:CCGGCCCTCACCTTGGTACTGATCACTCGAGTGATCAGTACCAAGGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_032752.1-2144s21c1
Sequence:CCGGAGAGCTTCACGCAGAACTATGCTCGAGCATAGTTCTGCGTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032752.1-1127s21c1
Sequence:CCGGCTCCATTCAAGGACATGATTTCTCGAGAAATCATGTCCTTGAATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_032752.1-2093s21c1
Sequence:CCGGACTTTCACCTGAAGGACAAAGCTCGAGCTTTGTCCTTCAGGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_032752.1-1719s21c1
Sequence:CCGGGGTCAACTTCATCCGGCATCTCTCGAGAGATGCCGGATGAAGTTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032752
VALIDATED
ZNF496 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 496
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032752.1-1503s1c1
Sequence:CCGGCCTGGATGAAGAAGTGACCATCTCGAGATGGTCACTTCTTCATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032752.1-1126s1c1
Sequence:CCGGTCTCCATTCAAGGACATGATTCTCGAGAATCATGTCCTTGAATGGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032752.1-2271s21c1
Sequence:CCGGCCCTCACCTTGGTACTGATCACTCGAGTGATCAGTACCAAGGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_032752.1-2144s21c1
Sequence:CCGGAGAGCTTCACGCAGAACTATGCTCGAGCATAGTTCTGCGTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032752.1-1127s21c1
Sequence:CCGGCTCCATTCAAGGACATGATTTCTCGAGAAATCATGTCCTTGAATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_032752.1-2093s21c1
Sequence:CCGGACTTTCACCTGAAGGACAAAGCTCGAGCTTTGTCCTTCAGGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_032752.1-1719s21c1
Sequence:CCGGGGTCAACTTCATCCGGCATCTCTCGAGAGATGCCGGATGAAGTTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032752
VALIDATED
ZNF496 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 496
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032752.1-1503s1c1
Sequence:CCGGCCTGGATGAAGAAGTGACCATCTCGAGATGGTCACTTCTTCATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032752.1-1126s1c1
Sequence:CCGGTCTCCATTCAAGGACATGATTCTCGAGAATCATGTCCTTGAATGGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032752.1-2271s21c1
Sequence:CCGGCCCTCACCTTGGTACTGATCACTCGAGTGATCAGTACCAAGGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_032752.1-2144s21c1
Sequence:CCGGAGAGCTTCACGCAGAACTATGCTCGAGCATAGTTCTGCGTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032752.1-1127s21c1
Sequence:CCGGCTCCATTCAAGGACATGATTTCTCGAGAAATCATGTCCTTGAATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_032752.1-2093s21c1
Sequence:CCGGACTTTCACCTGAAGGACAAAGCTCGAGCTTTGTCCTTCAGGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_032752.1-1719s21c1
Sequence:CCGGGGTCAACTTCATCCGGCATCTCTCGAGAGATGCCGGATGAAGTTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks