EMAIL THIS PAGE TO A FRIEND

ZNF497

zinc finger protein 497

Species: Human ZNF497(162968)
UniProtKB ID: Q6ZNH5, Q05AG8, Q0VF48, Q6ZTD2, Q9UIA8
Gene ID:
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198458 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150581 MISSION® esiRNA esiRNA human ZNF497 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198458 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204838 predicted 1751
2 SASI_Hs01_00204839 predicted 523
3 SASI_Hs01_00204840 predicted 1627
4 SASI_Hs01_00204841 predicted 1416
5 SASI_Hs01_00204842 predicted 1835
6 SASI_Hs01_00204844 predicted 767
7 SASI_Hs02_00371976 predicted 1289
8 SASI_Hs01_00204845 predicted 1998
9 SASI_Hs01_00204846 predicted 1537
10 SASI_Hs02_00371977 predicted 525
11 SASI_Hs01_00204843 predicted 1997
12 SASI_Hs01_00204847 predicted 1892
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198458
ZNF497 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 497
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198458.1-2185s21c1
Sequence:CCGGGCTTTCTAGTGTCTCATATTCCTCGAGGAATATGAGACACTAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198458.1-1984s21c1
Sequence:CCGGTCCGACAGGTGTGGCTATTTCCTCGAGGAAATAGCCACACCTGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198458.1-1203s21c1
Sequence:CCGGTTTCGTCATGGGCTCCTACCTCTCGAGAGGTAGGAGCCCATGACGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198458.1-2142s21c1
Sequence:CCGGCAACCACAGGTGACAGTTAAACTCGAGTTTAACTGTCACCTGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198458.1-1542s1c1
Sequence:CCGGCGTGCGCAAGTCGGAGCTCTTCTCGAGAAGAGCTCCGACTTGCGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198458.1-248s1c1
Sequence:CCGGGCAATGTGAAGACTGCCACGACTCGAGTCGTGGCAGTCTTCACATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198458.1-1112s1c1
Sequence:CCGGGAAAGGCTTTCCGCGAGAGCTCTCGAGAGCTCTCGCGGAAAGCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198458.1-1629s1c1
Sequence:CCGGCCACCGTTGCAACCTCAACGACTCGAGTCGTTGAGGTTGCAACGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198458.1-876s1c1
Sequence:CCGGGAACTCCAATTTCCTGGAGCACTCGAGTGCTCCAGGAAATTGGAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198458
ZNF497 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 497
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198458.1-2185s21c1
Sequence:CCGGGCTTTCTAGTGTCTCATATTCCTCGAGGAATATGAGACACTAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198458.1-1984s21c1
Sequence:CCGGTCCGACAGGTGTGGCTATTTCCTCGAGGAAATAGCCACACCTGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198458.1-1203s21c1
Sequence:CCGGTTTCGTCATGGGCTCCTACCTCTCGAGAGGTAGGAGCCCATGACGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198458.1-2142s21c1
Sequence:CCGGCAACCACAGGTGACAGTTAAACTCGAGTTTAACTGTCACCTGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198458.1-1542s1c1
Sequence:CCGGCGTGCGCAAGTCGGAGCTCTTCTCGAGAAGAGCTCCGACTTGCGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198458.1-248s1c1
Sequence:CCGGGCAATGTGAAGACTGCCACGACTCGAGTCGTGGCAGTCTTCACATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198458.1-1112s1c1
Sequence:CCGGGAAAGGCTTTCCGCGAGAGCTCTCGAGAGCTCTCGCGGAAAGCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198458.1-1629s1c1
Sequence:CCGGCCACCGTTGCAACCTCAACGACTCGAGTCGTTGAGGTTGCAACGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198458.1-876s1c1
Sequence:CCGGGAACTCCAATTTCCTGGAGCACTCGAGTGCTCCAGGAAATTGGAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198458
ZNF497 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 497
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198458.1-2185s21c1
Sequence:CCGGGCTTTCTAGTGTCTCATATTCCTCGAGGAATATGAGACACTAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198458.1-1984s21c1
Sequence:CCGGTCCGACAGGTGTGGCTATTTCCTCGAGGAAATAGCCACACCTGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198458.1-1203s21c1
Sequence:CCGGTTTCGTCATGGGCTCCTACCTCTCGAGAGGTAGGAGCCCATGACGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198458.1-2142s21c1
Sequence:CCGGCAACCACAGGTGACAGTTAAACTCGAGTTTAACTGTCACCTGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198458.1-1542s1c1
Sequence:CCGGCGTGCGCAAGTCGGAGCTCTTCTCGAGAAGAGCTCCGACTTGCGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198458.1-248s1c1
Sequence:CCGGGCAATGTGAAGACTGCCACGACTCGAGTCGTGGCAGTCTTCACATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198458.1-1112s1c1
Sequence:CCGGGAAAGGCTTTCCGCGAGAGCTCTCGAGAGCTCTCGCGGAAAGCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198458.1-1629s1c1
Sequence:CCGGCCACCGTTGCAACCTCAACGACTCGAGTCGTTGAGGTTGCAACGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198458.1-876s1c1
Sequence:CCGGGAACTCCAATTTCCTGGAGCACTCGAGTGCTCCAGGAAATTGGAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks