EMAIL THIS PAGE TO A FRIEND

ZNF500

zinc finger protein 500

Synonyms: ZKSCAN18 ZSCAN50
UniProtKB ID: O60304, A8K6X7, Q0VAL2, Q96CQ8, Q9BTG0
Gene ID:
domestic cat(101092727) zinc finger protein 500
dog(490023) zinc finger protein 500
cow(510490) zinc finger protein 500
sheep(101103529) zinc finger protein 500
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_085507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_085507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_085507 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130261 MISSION® esiRNA esiRNA human ZNF500 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021646 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048820 predicted 1295
2 SASI_Hs01_00048821 predicted 1311
3 SASI_Hs01_00048822 predicted 1713
4 SASI_Hs01_00048823 predicted 1742
5 SASI_Hs01_00048824 predicted 818
6 SASI_Hs01_00048825 predicted 1326
7 SASI_Hs01_00048826 predicted 1715
8 SASI_Hs01_00048827 predicted 1048
9 SASI_Hs01_00048828 predicted 1676
10 SASI_Hs01_00048829 predicted 394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_085507
ZNF500 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 500
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085507.5-847s1c1
Sequence:CCGGCCCGTTGAGAATGGAGTGGTACTCGAGTACCACTCCATTCTCAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085507.5-547s1c1
Sequence:CCGGCCTGGAGGAAGAGGCTCGATTCTCGAGAATCGAGCCTCTTCCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085507.5-1094s1c1
Sequence:CCGGCCTTACAAGTGCCTAGTCTGTCTCGAGACAGACTAGGCACTTGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085507.5-1288s1c1
Sequence:CCGGGCGCTTCAACAACAGCTCGCACTCGAGTGCGAGCTGTTGTTGAAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085507.5-122s1c1
Sequence:CCGGGAGGAGGACTTCTGCTTGGAACTCGAGTTCCAAGCAGAAGTCCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_085507
ZNF500 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 500
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085507.5-847s1c1
Sequence:CCGGCCCGTTGAGAATGGAGTGGTACTCGAGTACCACTCCATTCTCAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085507.5-547s1c1
Sequence:CCGGCCTGGAGGAAGAGGCTCGATTCTCGAGAATCGAGCCTCTTCCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085507.5-1094s1c1
Sequence:CCGGCCTTACAAGTGCCTAGTCTGTCTCGAGACAGACTAGGCACTTGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085507.5-1288s1c1
Sequence:CCGGGCGCTTCAACAACAGCTCGCACTCGAGTGCGAGCTGTTGTTGAAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085507.5-122s1c1
Sequence:CCGGGAGGAGGACTTCTGCTTGGAACTCGAGTTCCAAGCAGAAGTCCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_085507
ZNF500 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 500
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085507.5-847s1c1
Sequence:CCGGCCCGTTGAGAATGGAGTGGTACTCGAGTACCACTCCATTCTCAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085507.5-547s1c1
Sequence:CCGGCCTGGAGGAAGAGGCTCGATTCTCGAGAATCGAGCCTCTTCCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085507.5-1094s1c1
Sequence:CCGGCCTTACAAGTGCCTAGTCTGTCTCGAGACAGACTAGGCACTTGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085507.5-1288s1c1
Sequence:CCGGGCGCTTCAACAACAGCTCGCACTCGAGTGCGAGCTGTTGTTGAAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085507.5-122s1c1
Sequence:CCGGGAGGAGGACTTCTGCTTGGAACTCGAGTTCCAAGCAGAAGTCCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks