EMAIL THIS PAGE TO A FRIEND

ZNF501

zinc finger protein 501

Synonyms: ZNF ZNF52
UniProtKB ID: Q96CX3, B4DLY7, Q96NU9
Gene ID:
sheep(101121888) zinc finger protein 501
dog(100688999) zinc finger protein 501
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145044 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145044 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064511 predicted 832
2 SASI_Hs01_00064512 predicted 644
3 SASI_Hs01_00064513 predicted 995
4 SASI_Hs01_00064514 predicted 571
5 SASI_Hs01_00064516 predicted 829
6 SASI_Hs01_00064517 predicted 569
7 SASI_Hs01_00064518 predicted 832
8 SASI_Hs01_00064519 predicted 1009
9 SASI_Hs01_00064510 predicted 664
10 SASI_Hs02_00364922 predicted 567
11 SASI_Hs01_00064515 predicted 864
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145044
ZNF501 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 501
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145044.1-1003s1c1
Sequence:CCGGCAGAACTCTTCCCTTGTTGAACTCGAGTTCAACAAGGGAAGAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145044.1-762s1c1
Sequence:CCGGCCTTATTAAACACCAGCGAATCTCGAGATTCGCTGGTGTTTAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145044.1-557s1c1
Sequence:CCGGGCAGTGAATGTGGAAGTTGTTCTCGAGAACAACTTCCACATTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145044.1-1890s1c1
Sequence:CCGGCCCTGACATTAACTGAATAAACTCGAGTTTATTCAGTTAATGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145044.1-1082s1c1
Sequence:CCGGTCCGCAAACAAGCACACCTTACTCGAGTAAGGTGTGCTTGTTTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145044.2-1574s21c1
Sequence:CCGGATTGTTGTTTGGTTCTCATAACTCGAGTTATGAGAACCAAACAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145044.2-578s21c1
Sequence:CCGGCCGTAAACAGTCAAATCTTACCTCGAGGTAAGATTTGACTGTTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145044.2-840s21c1
Sequence:CCGGATATGCCTTACTCGTCATCAGCTCGAGCTGATGACGAGTAAGGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145044
ZNF501 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 501
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145044.1-1003s1c1
Sequence:CCGGCAGAACTCTTCCCTTGTTGAACTCGAGTTCAACAAGGGAAGAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145044.1-762s1c1
Sequence:CCGGCCTTATTAAACACCAGCGAATCTCGAGATTCGCTGGTGTTTAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145044.1-557s1c1
Sequence:CCGGGCAGTGAATGTGGAAGTTGTTCTCGAGAACAACTTCCACATTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145044.1-1890s1c1
Sequence:CCGGCCCTGACATTAACTGAATAAACTCGAGTTTATTCAGTTAATGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145044.1-1082s1c1
Sequence:CCGGTCCGCAAACAAGCACACCTTACTCGAGTAAGGTGTGCTTGTTTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145044.2-1574s21c1
Sequence:CCGGATTGTTGTTTGGTTCTCATAACTCGAGTTATGAGAACCAAACAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145044.2-578s21c1
Sequence:CCGGCCGTAAACAGTCAAATCTTACCTCGAGGTAAGATTTGACTGTTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145044.2-840s21c1
Sequence:CCGGATATGCCTTACTCGTCATCAGCTCGAGCTGATGACGAGTAAGGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145044
ZNF501 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 501
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145044.1-1003s1c1
Sequence:CCGGCAGAACTCTTCCCTTGTTGAACTCGAGTTCAACAAGGGAAGAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145044.1-762s1c1
Sequence:CCGGCCTTATTAAACACCAGCGAATCTCGAGATTCGCTGGTGTTTAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145044.1-557s1c1
Sequence:CCGGGCAGTGAATGTGGAAGTTGTTCTCGAGAACAACTTCCACATTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145044.1-1890s1c1
Sequence:CCGGCCCTGACATTAACTGAATAAACTCGAGTTTATTCAGTTAATGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145044.1-1082s1c1
Sequence:CCGGTCCGCAAACAAGCACACCTTACTCGAGTAAGGTGTGCTTGTTTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145044.2-1574s21c1
Sequence:CCGGATTGTTGTTTGGTTCTCATAACTCGAGTTATGAGAACCAAACAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145044.2-578s21c1
Sequence:CCGGCCGTAAACAGTCAAATCTTACCTCGAGGTAAGATTTGACTGTTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145044.2-840s21c1
Sequence:CCGGATATGCCTTACTCGTCATCAGCTCGAGCTGATGACGAGTAAGGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks