EMAIL THIS PAGE TO A FRIEND

ZNF502

zinc finger protein 502

UniProtKB ID: Q8TBZ5
Gene ID:
domestic cat(101080434) zinc finger protein 502
Horse(100065949) zinc finger protein 502
dog(100688922) zinc finger protein 502
cow(539265) zinc finger protein 502
sheep(101121045) zinc finger protein 502
naked mole-rat(101728355) zinc finger protein 502
domestic guinea pig(101787276) zinc finger protein 502
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033210 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133291 MISSION® esiRNA esiRNA human ZNF502 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033210 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046985 predicted 507
2 SASI_Hs01_00046986 predicted 1047
3 SASI_Hs01_00046987 predicted 1568
4 SASI_Hs02_00361006 predicted 1908
5 SASI_Hs01_00046988 predicted 660
6 SASI_Hs01_00046989 predicted 1074
7 SASI_Hs01_00046990 predicted 396
8 SASI_Hs01_00046992 predicted 626
9 SASI_Hs01_00046993 predicted 986
10 SASI_Hs02_00361007 predicted 541
11 SASI_Hs01_00046991 predicted 401
12 SASI_Hs01_00046994 predicted 841
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033210
ZNF502 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 502
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033210.4-1876s21c1
Sequence:CCGGACTTCACAGTGGTGACTAATGCTCGAGCATTAGTCACCACTGTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033210.4-640s21c1
Sequence:CCGGTCAGTGGGAAACAAGTAATATCTCGAGATATTACTTGTTTCCCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033210.3-836s1c1
Sequence:CCGGCGTAGTTCATTCCTTGTTCAACTCGAGTTGAACAAGGAATGAACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033210.3-923s1c1
Sequence:CCGGCGATCATTTCTTACTCAGCATCTCGAGATGCTGAGTAAGAAATGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033210.3-1755s1c1
Sequence:CCGGTCCGCAAGTATGCACACCTTACTCGAGTAAGGTGTGCATACTTGCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033210.3-1084s1c1
Sequence:CCGGCAATCAGAATACACACCTTATCTCGAGATAAGGTGTGTATTCTGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033210.3-508s1c1
Sequence:CCGGGAGAATAACTTTCATCCACAACTCGAGTTGTGGATGAAAGTTATTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033210
ZNF502 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 502
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033210.4-1876s21c1
Sequence:CCGGACTTCACAGTGGTGACTAATGCTCGAGCATTAGTCACCACTGTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033210.4-640s21c1
Sequence:CCGGTCAGTGGGAAACAAGTAATATCTCGAGATATTACTTGTTTCCCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033210.3-836s1c1
Sequence:CCGGCGTAGTTCATTCCTTGTTCAACTCGAGTTGAACAAGGAATGAACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033210.3-923s1c1
Sequence:CCGGCGATCATTTCTTACTCAGCATCTCGAGATGCTGAGTAAGAAATGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033210.3-1755s1c1
Sequence:CCGGTCCGCAAGTATGCACACCTTACTCGAGTAAGGTGTGCATACTTGCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033210.3-1084s1c1
Sequence:CCGGCAATCAGAATACACACCTTATCTCGAGATAAGGTGTGTATTCTGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033210.3-508s1c1
Sequence:CCGGGAGAATAACTTTCATCCACAACTCGAGTTGTGGATGAAAGTTATTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033210
ZNF502 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 502
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033210.4-1876s21c1
Sequence:CCGGACTTCACAGTGGTGACTAATGCTCGAGCATTAGTCACCACTGTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033210.4-640s21c1
Sequence:CCGGTCAGTGGGAAACAAGTAATATCTCGAGATATTACTTGTTTCCCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033210.3-836s1c1
Sequence:CCGGCGTAGTTCATTCCTTGTTCAACTCGAGTTGAACAAGGAATGAACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033210.3-923s1c1
Sequence:CCGGCGATCATTTCTTACTCAGCATCTCGAGATGCTGAGTAAGAAATGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033210.3-1755s1c1
Sequence:CCGGTCCGCAAGTATGCACACCTTACTCGAGTAAGGTGTGCATACTTGCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033210.3-1084s1c1
Sequence:CCGGCAATCAGAATACACACCTTATCTCGAGATAAGGTGTGTATTCTGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033210.3-508s1c1
Sequence:CCGGGAGAATAACTTTCATCCACAACTCGAGTTGTGGATGAAAGTTATTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks