EMAIL THIS PAGE TO A FRIEND

ZNF503

zinc finger protein 503

Synonyms: NOLZ-1 NOLZ1
UniProtKB ID: Q96F45, Q8NAC5, Q96E25, Q96IJ0
Gene ID:
domestic guinea pig(100727787) zinc finger protein 503
naked mole-rat(101725643) zinc finger protein 503
cow(789846) zinc finger protein 503
sheep(101104204) zinc finger protein 503
Zebrafish(324913) zinc finger protein 503
domestic cat(101093548) zinc finger protein 503
dog(489058) zinc finger protein 503
chicken(770136) zinc finger protein 503
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032772 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032772 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032772 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032772 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236681 predicted 1513
2 SASI_Hs01_00236682 predicted 1837
3 SASI_Hs01_00236683 predicted 1108
4 SASI_Hs01_00236684 predicted 1530
5 SASI_Hs02_00360308 predicted 1871
6 SASI_Hs01_00236685 predicted 1751
7 SASI_Hs02_00360309 predicted 1875
8 SASI_Hs01_00236687 predicted 1540
9 SASI_Hs01_00236688 predicted 1175
10 SASI_Hs01_00236689 predicted 1875
11 SASI_Hs01_00236686 predicted 1950
12 SASI_Hs01_00236690 predicted 1269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032772
VALIDATED
ZNF503 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 503
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144218    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032772.3-2303s1c1
Sequence:CCGGCCACGAAAGGAAAGAAATGTACTCGAGTACATTTCTTTCCTTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032772.3-2033s1c1
Sequence:CCGGGCTGGGACTCAGCAGCCGCTACTCGAGTAGCGGCTGCTGAGTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143385    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032772.3-2302s1c1
Sequence:CCGGGCCACGAAAGGAAAGAAATGTCTCGAGACATTTCTTTCCTTTCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032772.3-1112s1c1
Sequence:CCGGCGGGATTAATGTGGATGTGAACTCGAGTTCACATCCACATTAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032772.3-761s1c1
Sequence:CCGGCAAGTCGAGTTTCAAGCCGTACTCGAGTACGGCTTGAAACTCGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032772.3-1754s1c1
Sequence:CCGGCTACGGCTTTATGCTCCCTAACTCGAGTTAGGGAGCATAAAGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032772.3-275s1c1
Sequence:CCGGCCTAAGAAGCAGTAAGCACAGCTCGAGCTGTGCTTACTGCTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032772.3-464s1c1
Sequence:CCGGGCCAATCAAGGTGCTGAAGATCTCGAGATCTTCAGCACCTTGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032772.3-767s1c1
Sequence:CCGGGAGTTTCAAGCCGTACTCCAACTCGAGTTGGAGTACGGCTTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_032772.3-2474s1c1
Sequence:CCGGGTGTTCATCTGAGGACTGCATCTCGAGATGCAGTCCTCAGATGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032772.4-1951s21c1
Sequence:CCGGTTGCGGACCCATACGGCATTTCTCGAGAAATGCCGTATGGGTCCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032772.4-684s21c1
Sequence:CCGGGGCGCAAACATGTTCGCAGATCTCGAGATCTGCGAACATGTTTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032772.4-2648s21c1
Sequence:CCGGAGTTTGAGCTCTGTAGGTAAACTCGAGTTTACCTACAGAGCTCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032772
VALIDATED
ZNF503 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 503
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144218    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032772.3-2303s1c1
Sequence:CCGGCCACGAAAGGAAAGAAATGTACTCGAGTACATTTCTTTCCTTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032772.3-2033s1c1
Sequence:CCGGGCTGGGACTCAGCAGCCGCTACTCGAGTAGCGGCTGCTGAGTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143385    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032772.3-2302s1c1
Sequence:CCGGGCCACGAAAGGAAAGAAATGTCTCGAGACATTTCTTTCCTTTCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032772.3-1112s1c1
Sequence:CCGGCGGGATTAATGTGGATGTGAACTCGAGTTCACATCCACATTAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032772.3-761s1c1
Sequence:CCGGCAAGTCGAGTTTCAAGCCGTACTCGAGTACGGCTTGAAACTCGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032772.3-1754s1c1
Sequence:CCGGCTACGGCTTTATGCTCCCTAACTCGAGTTAGGGAGCATAAAGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032772.3-275s1c1
Sequence:CCGGCCTAAGAAGCAGTAAGCACAGCTCGAGCTGTGCTTACTGCTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032772.3-464s1c1
Sequence:CCGGGCCAATCAAGGTGCTGAAGATCTCGAGATCTTCAGCACCTTGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032772.3-767s1c1
Sequence:CCGGGAGTTTCAAGCCGTACTCCAACTCGAGTTGGAGTACGGCTTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_032772.3-2474s1c1
Sequence:CCGGGTGTTCATCTGAGGACTGCATCTCGAGATGCAGTCCTCAGATGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032772.4-1951s21c1
Sequence:CCGGTTGCGGACCCATACGGCATTTCTCGAGAAATGCCGTATGGGTCCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032772.4-684s21c1
Sequence:CCGGGGCGCAAACATGTTCGCAGATCTCGAGATCTGCGAACATGTTTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032772.4-2648s21c1
Sequence:CCGGAGTTTGAGCTCTGTAGGTAAACTCGAGTTTACCTACAGAGCTCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032772
VALIDATED
ZNF503 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 503
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144218    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032772.3-2303s1c1
Sequence:CCGGCCACGAAAGGAAAGAAATGTACTCGAGTACATTTCTTTCCTTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032772.3-2033s1c1
Sequence:CCGGGCTGGGACTCAGCAGCCGCTACTCGAGTAGCGGCTGCTGAGTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143385    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032772.3-2302s1c1
Sequence:CCGGGCCACGAAAGGAAAGAAATGTCTCGAGACATTTCTTTCCTTTCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032772.3-1112s1c1
Sequence:CCGGCGGGATTAATGTGGATGTGAACTCGAGTTCACATCCACATTAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032772.3-761s1c1
Sequence:CCGGCAAGTCGAGTTTCAAGCCGTACTCGAGTACGGCTTGAAACTCGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032772.3-1754s1c1
Sequence:CCGGCTACGGCTTTATGCTCCCTAACTCGAGTTAGGGAGCATAAAGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032772.3-275s1c1
Sequence:CCGGCCTAAGAAGCAGTAAGCACAGCTCGAGCTGTGCTTACTGCTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032772.3-464s1c1
Sequence:CCGGGCCAATCAAGGTGCTGAAGATCTCGAGATCTTCAGCACCTTGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032772.3-767s1c1
Sequence:CCGGGAGTTTCAAGCCGTACTCCAACTCGAGTTGGAGTACGGCTTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_032772.3-2474s1c1
Sequence:CCGGGTGTTCATCTGAGGACTGCATCTCGAGATGCAGTCCTCAGATGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032772.4-1951s21c1
Sequence:CCGGTTGCGGACCCATACGGCATTTCTCGAGAAATGCCGTATGGGTCCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032772.4-684s21c1
Sequence:CCGGGGCGCAAACATGTTCGCAGATCTCGAGATCTGCGAACATGTTTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032772.4-2648s21c1
Sequence:CCGGAGTTTGAGCTCTGTAGGTAAACTCGAGTTTACCTACAGAGCTCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks