EMAIL THIS PAGE TO A FRIEND

ZNF506

zinc finger protein 506

Species: Human ZNF506(440515)
UniProtKB ID: Q5JVG8, B3KTH6
Gene ID:
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301853 ANTI-ZNF506 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099269 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099269 Rosetta Predictions human pricing
XM_930521 Rosetta Predictions human pricing
XM_935240 Rosetta Predictions human pricing
XM_935241 Rosetta Predictions human pricing
XM_935242 Rosetta Predictions human pricing
XM_935243 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320289 predicted 329
2 SASI_Hs02_00320290 predicted 756
3 SASI_Hs02_00320291 predicted 698
4 SASI_Hs02_00320292 predicted 597
5 SASI_Hs02_00320293 predicted 1199
6 SASI_Hs02_00320294 predicted 853
7 SASI_Hs02_00320295 predicted 1415
8 SASI_Hs02_00320296 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271053 predicted 326
2 SASI_Hs01_00271054 predicted 761
3 SASI_Hs01_00271055 predicted 699
4 SASI_Hs01_00271056 predicted 594
5 SASI_Hs01_00271057 predicted 1193
6 SASI_Hs01_00271058 predicted 850
7 SASI_Hs01_00271059 predicted 1414
8 SASI_Hs01_00271060 predicted 848
9 SASI_Hs01_00271061 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252280 predicted 295
2 SASI_Hs01_00252281 predicted 559
3 SASI_Hs01_00252282 predicted 510
4 SASI_Hs01_00252283 predicted 400
5 SASI_Hs01_00252284 predicted 665
6 SASI_Hs01_00252285 predicted 724
7 SASI_Hs01_00252286 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292893 predicted 261
2 SASI_Hs01_00292894 predicted 662
3 SASI_Hs01_00292895 predicted 603
4 SASI_Hs01_00292896 predicted 494
5 SASI_Hs01_00292897 predicted 1098
6 SASI_Hs01_00292898 predicted 749
7 SASI_Hs01_00292899 predicted 1320
8 SASI_Hs01_00292900 predicted 261
9 SASI_Hs01_00292901 predicted 750
10 SASI_Hs01_00292902 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286759 predicted 4646
2 SASI_Hs01_00286760 predicted 4585
3 SASI_Hs01_00286761 predicted 4488
4 SASI_Hs01_00286762 predicted 5090
5 SASI_Hs01_00286763 predicted 4743
6 SASI_Hs01_00286764 predicted 5303
7 SASI_Hs01_00286765 predicted 4741
8 SASI_Hs01_00286766 predicted 4328
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260750 predicted 3065
2 SASI_Hs01_00260751 predicted 4534
3 SASI_Hs01_00260752 predicted 3436
4 SASI_Hs01_00260753 predicted 4072
5 SASI_Hs01_00260754 predicted 1799
6 SASI_Hs01_00260755 predicted 4367
7 SASI_Hs01_00260756 predicted 1749
8 SASI_Hs01_00260757 predicted 3009
9 SASI_Hs01_00260758 predicted 4040
10 SASI_Hs01_00260759 predicted 3923
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099269
ZNF506 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 506
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-214s21c1
Sequence:CCGGCGCTGCACAGCGGAATCTATACTCGAGTATAGATTCCGCTGTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-1463s21c1
Sequence:CCGGCCCTTAATAAGCATAAGATAACTCGAGTTATCTTATGCTTATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099269.1-2023s21c1
Sequence:CCGGTTAAGAGACATGGCGATAATTCTCGAGAATTATCGCCATGTCTCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-734s21c1
Sequence:CCGGGCTGGAGAGAAACGCTATAAACTCGAGTTTATAGCGTTTCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-1034s21c1
Sequence:CCGGTCATCCTCAACCCTTACTAAACTCGAGTTTAGTAAGGGTTGAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-1118s21c1
Sequence:GTACCGGCGTTCCTCAAACCTTACTAAACTCGAGTTTAGTAAGGTTTGAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099269.1-1539s21c1
Sequence:CCGGGCCCTGGACTCTGACTAAATACTCGAGTATTTAGTCAGAGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-1407s21c1
Sequence:CCGGTTAGACAGAAACCCTGCATAGCTCGAGCTATGCAGGGTTTCTGTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-1202s21c1
Sequence:CCGGTGGTACTCAAGCCTCTCTAAACTCGAGTTTAGAGAGGCTTGAGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-857s21c1
Sequence:CCGGGCCTATAAGCAGTCCTGTAACCTCGAGGTTACAGGACTGCTTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099269
ZNF506 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 506
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-214s21c1
Sequence:CCGGCGCTGCACAGCGGAATCTATACTCGAGTATAGATTCCGCTGTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-1463s21c1
Sequence:CCGGCCCTTAATAAGCATAAGATAACTCGAGTTATCTTATGCTTATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099269.1-2023s21c1
Sequence:CCGGTTAAGAGACATGGCGATAATTCTCGAGAATTATCGCCATGTCTCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-734s21c1
Sequence:CCGGGCTGGAGAGAAACGCTATAAACTCGAGTTTATAGCGTTTCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-1034s21c1
Sequence:CCGGTCATCCTCAACCCTTACTAAACTCGAGTTTAGTAAGGGTTGAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-1118s21c1
Sequence:GTACCGGCGTTCCTCAAACCTTACTAAACTCGAGTTTAGTAAGGTTTGAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099269.1-1539s21c1
Sequence:CCGGGCCCTGGACTCTGACTAAATACTCGAGTATTTAGTCAGAGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-1407s21c1
Sequence:CCGGTTAGACAGAAACCCTGCATAGCTCGAGCTATGCAGGGTTTCTGTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-1202s21c1
Sequence:CCGGTGGTACTCAAGCCTCTCTAAACTCGAGTTTAGAGAGGCTTGAGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-857s21c1
Sequence:CCGGGCCTATAAGCAGTCCTGTAACCTCGAGGTTACAGGACTGCTTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099269
ZNF506 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 506
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-214s21c1
Sequence:CCGGCGCTGCACAGCGGAATCTATACTCGAGTATAGATTCCGCTGTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-1463s21c1
Sequence:CCGGCCCTTAATAAGCATAAGATAACTCGAGTTATCTTATGCTTATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099269.1-2023s21c1
Sequence:CCGGTTAAGAGACATGGCGATAATTCTCGAGAATTATCGCCATGTCTCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-734s21c1
Sequence:CCGGGCTGGAGAGAAACGCTATAAACTCGAGTTTATAGCGTTTCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-1034s21c1
Sequence:CCGGTCATCCTCAACCCTTACTAAACTCGAGTTTAGTAAGGGTTGAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-1118s21c1
Sequence:GTACCGGCGTTCCTCAAACCTTACTAAACTCGAGTTTAGTAAGGTTTGAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099269.1-1539s21c1
Sequence:CCGGGCCCTGGACTCTGACTAAATACTCGAGTATTTAGTCAGAGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-1407s21c1
Sequence:CCGGTTAGACAGAAACCCTGCATAGCTCGAGCTATGCAGGGTTTCTGTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-1202s21c1
Sequence:CCGGTGGTACTCAAGCCTCTCTAAACTCGAGTTTAGAGAGGCTTGAGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099269.1-857s21c1
Sequence:CCGGGCCTATAAGCAGTCCTGTAACCTCGAGGTTACAGGACTGCTTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks