EMAIL THIS PAGE TO A FRIEND

ZNF507

zinc finger protein 507

UniProtKB ID: Q8TCN5, A8K911, Q2TBF1, Q6MZU0, Q9UPR8
Gene ID:
Zebrafish(393453) zinc finger protein 507
dog(484604) zinc finger protein 507
Horse(100049877) zinc finger protein 507
domestic cat(101093064) zinc finger protein 507
chicken(415764) zinc finger protein 507
cow(540613) zinc finger protein 507
sheep(101107623) zinc finger protein 507
domestic guinea pig(100717536) zinc finger protein 507
150 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014910 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070851 MISSION® esiRNA esiRNA human ZNF507 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014910 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120672 predicted 840
2 SASI_Hs01_00120673 predicted 2791
3 SASI_Hs01_00120674 predicted 1432
4 SASI_Hs01_00120675 predicted 2029
5 SASI_Hs01_00120676 predicted 2383
6 SASI_Hs02_00346549 predicted 957
7 SASI_Hs01_00120677 predicted 1686
8 SASI_Hs01_00120678 predicted 790
9 SASI_Hs01_00120679 predicted 852
10 SASI_Hs01_00120680 predicted 2105
11 SASI_Hs01_00120681 predicted 219
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014910
ZNF507 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 507
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014910.3-1635s1c1
Sequence:CCGGCCCTTGTCACAATGCCTATAACTCGAGTTATAGGCATTGTGACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014910.3-2590s1c1
Sequence:CCGGACAAGTAAACAAGGCTATTAACTCGAGTTAATAGCCTTGTTTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014910.2-659s1c1
Sequence:CCGGCGTGGTGAATGACCATGACAACTCGAGTTGTCATGGTCATTCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014910.2-783s1c1
Sequence:CCGGCCAGTAAGTGTGGACAATCTACTCGAGTAGATTGTCCACACTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014910.2-875s1c1
Sequence:CCGGCGGCATGTATCGATGCTTGTTCTCGAGAACAAGCATCGATACATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014910.2-2651s1c1
Sequence:CCGGCCCTGGAAAGACTCAATTAAACTCGAGTTTAATTGAGTCTTTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014910.2-7113s1c1
Sequence:CCGGCGAAGGAATTAGCATTCCTTACTCGAGTAAGGAATGCTAATTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014910.2-261s1c1
Sequence:CCGGCCAGATCCATTAATCCATGTTCTCGAGAACATGGATTAATGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014910.2-7225s1c1
Sequence:CCGGGCTAACATCATCTGACTGTATCTCGAGATACAGTCAGATGATGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014910.2-1443s1c1
Sequence:CCGGCGCGAAGGAATGGATGATGTTCTCGAGAACATCATCCATTCCTTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014910
ZNF507 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 507
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014910.3-1635s1c1
Sequence:CCGGCCCTTGTCACAATGCCTATAACTCGAGTTATAGGCATTGTGACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014910.3-2590s1c1
Sequence:CCGGACAAGTAAACAAGGCTATTAACTCGAGTTAATAGCCTTGTTTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014910.2-659s1c1
Sequence:CCGGCGTGGTGAATGACCATGACAACTCGAGTTGTCATGGTCATTCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014910.2-783s1c1
Sequence:CCGGCCAGTAAGTGTGGACAATCTACTCGAGTAGATTGTCCACACTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014910.2-875s1c1
Sequence:CCGGCGGCATGTATCGATGCTTGTTCTCGAGAACAAGCATCGATACATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014910.2-2651s1c1
Sequence:CCGGCCCTGGAAAGACTCAATTAAACTCGAGTTTAATTGAGTCTTTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014910.2-7113s1c1
Sequence:CCGGCGAAGGAATTAGCATTCCTTACTCGAGTAAGGAATGCTAATTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014910.2-261s1c1
Sequence:CCGGCCAGATCCATTAATCCATGTTCTCGAGAACATGGATTAATGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014910.2-7225s1c1
Sequence:CCGGGCTAACATCATCTGACTGTATCTCGAGATACAGTCAGATGATGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014910.2-1443s1c1
Sequence:CCGGCGCGAAGGAATGGATGATGTTCTCGAGAACATCATCCATTCCTTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014910
ZNF507 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 507
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014910.3-1635s1c1
Sequence:CCGGCCCTTGTCACAATGCCTATAACTCGAGTTATAGGCATTGTGACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014910.3-2590s1c1
Sequence:CCGGACAAGTAAACAAGGCTATTAACTCGAGTTAATAGCCTTGTTTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014910.2-659s1c1
Sequence:CCGGCGTGGTGAATGACCATGACAACTCGAGTTGTCATGGTCATTCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014910.2-783s1c1
Sequence:CCGGCCAGTAAGTGTGGACAATCTACTCGAGTAGATTGTCCACACTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014910.2-875s1c1
Sequence:CCGGCGGCATGTATCGATGCTTGTTCTCGAGAACAAGCATCGATACATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014910.2-2651s1c1
Sequence:CCGGCCCTGGAAAGACTCAATTAAACTCGAGTTTAATTGAGTCTTTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014910.2-7113s1c1
Sequence:CCGGCGAAGGAATTAGCATTCCTTACTCGAGTAAGGAATGCTAATTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014910.2-261s1c1
Sequence:CCGGCCAGATCCATTAATCCATGTTCTCGAGAACATGGATTAATGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014910.2-7225s1c1
Sequence:CCGGGCTAACATCATCTGACTGTATCTCGAGATACAGTCAGATGATGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014910.2-1443s1c1
Sequence:CCGGCGCGAAGGAATGGATGATGTTCTCGAGAACATCATCCATTCCTTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks