EMAIL THIS PAGE TO A FRIEND

ZNF510

zinc finger protein 510

UniProtKB ID: Q9Y2H8, Q5SZP5
Gene ID:
Domestic Rabbit(100347369) zinc finger protein 510
dog(100686031) zinc finger protein 510
domestic cat(101090398) zinc finger protein 510
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014930 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014930 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014930 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156621 MISSION® esiRNA esiRNA human ZNF510 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014930 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072003 predicted 2172
2 SASI_Hs01_00072004 predicted 1722
3 SASI_Hs01_00072006 predicted 2227
4 SASI_Hs02_00346590 predicted 548
5 SASI_Hs01_00072007 predicted 987
6 SASI_Hs01_00072008 predicted 1996
7 SASI_Hs01_00072009 predicted 1305
8 SASI_Hs01_00072010 predicted 1145
9 SASI_Hs01_00072011 predicted 1283
10 SASI_Hs01_00072012 predicted 650
11 SASI_Hs01_00072005 predicted 1388
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014930
VALIDATED
ZNF510 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 510
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_014930.1-1304s1c1
Sequence:CCGGCTTGGGTTAAATCCTCTGAATCTCGAGATTCAGAGGATTTAACCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014930.1-4947s1c1
Sequence:CCGGGCCCATAATAAGAGACTATTTCTCGAGAAATAGTCTCTTATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014930.1-2020s1c1
Sequence:CCGGCGGAAAGCAATCCTTAGTGATCTCGAGATCACTAAGGATTGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014930.1-918s1c1
Sequence:CCGGGCATCCAAAGTTTCAAACTTTCTCGAGAAAGTTTGAAACTTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_014930.1-910s1c1
Sequence:CCGGCTTCCCAAGCATCCAAAGTTTCTCGAGAAACTTTGGATGCTTGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014930
VALIDATED
ZNF510 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 510
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_014930.1-1304s1c1
Sequence:CCGGCTTGGGTTAAATCCTCTGAATCTCGAGATTCAGAGGATTTAACCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014930.1-4947s1c1
Sequence:CCGGGCCCATAATAAGAGACTATTTCTCGAGAAATAGTCTCTTATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014930.1-2020s1c1
Sequence:CCGGCGGAAAGCAATCCTTAGTGATCTCGAGATCACTAAGGATTGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014930.1-918s1c1
Sequence:CCGGGCATCCAAAGTTTCAAACTTTCTCGAGAAAGTTTGAAACTTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_014930.1-910s1c1
Sequence:CCGGCTTCCCAAGCATCCAAAGTTTCTCGAGAAACTTTGGATGCTTGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014930
VALIDATED
ZNF510 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 510
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_014930.1-1304s1c1
Sequence:CCGGCTTGGGTTAAATCCTCTGAATCTCGAGATTCAGAGGATTTAACCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014930.1-4947s1c1
Sequence:CCGGGCCCATAATAAGAGACTATTTCTCGAGAAATAGTCTCTTATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014930.1-2020s1c1
Sequence:CCGGCGGAAAGCAATCCTTAGTGATCTCGAGATCACTAAGGATTGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014930.1-918s1c1
Sequence:CCGGGCATCCAAAGTTTCAAACTTTCTCGAGAAAGTTTGAAACTTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_014930.1-910s1c1
Sequence:CCGGCTTCCCAAGCATCCAAAGTTTCTCGAGAAACTTTGGATGCTTGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks