EMAIL THIS PAGE TO A FRIEND

ZNF511

zinc finger protein 511

UniProtKB ID: Q8NB15, A8K8L5, Q8WUP1, Q96BV2
Gene ID:
Zebrafish(368916) zinc finger protein 511
chicken(428940) zinc finger protein 511
domestic cat(101089145) zinc finger protein 511
dog(608198) zinc finger protein 511
naked mole-rat(101700833) zinc finger protein 511
domestic guinea pig(100728770) zinc finger protein 511
cow(616110) zinc finger protein 511
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145806 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158061 MISSION® esiRNA esiRNA human ZNF511 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145806 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125161 predicted 446
2 SASI_Hs01_00125162 predicted 328
3 SASI_Hs01_00125164 predicted 679
4 SASI_Hs01_00125165 predicted 537
5 SASI_Hs02_00365361 predicted 338
6 SASI_Hs01_00125166 predicted 679
7 SASI_Hs01_00125167 predicted 371
8 SASI_Hs02_00365362 predicted 464
9 SASI_Hs01_00125168 predicted 676
10 SASI_Hs01_00125169 predicted 318
11 SASI_Hs01_00125163 predicted 431
12 SASI_Hs01_00125170 predicted 695
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145806
VALIDATED
ZNF511 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 511
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145806.2-337s1c1
Sequence:CCGGGCACGGAAATGTTTGCTCCTTCTCGAGAAGGAGCAAACATTTCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145806.2-508s1c1
Sequence:CCGGGAAGGATCACATGGTGAGGATCTCGAGATCCTCACCATGTGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_145806.2-689s1c1
Sequence:CCGGCGGATCTACAGACATAGAATACTCGAGTATTCTATGTCTGTAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_145806.2-551s1c1
Sequence:CCGGCGGTTTGATAAGCCAAAGAAACTCGAGTTTCTTTGGCTTATCAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145806.2-908s1c1
Sequence:CCGGGTTCCTCAGCAAATGGCATTACTCGAGTAATGCCATTTGCTGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145806.2-449s1c1
Sequence:CCGGGACATGTATCAGTGCTTGGTACTCGAGTACCAAGCACTGATACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145806.2-550s1c1
Sequence:CCGGCCGGTTTGATAAGCCAAAGAACTCGAGTTCTTTGGCTTATCAAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_145806.2-547s1c1
Sequence:CCGGCTTCCGGTTTGATAAGCCAAACTCGAGTTTGGCTTATCAAACCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145806.2-901s1c1
Sequence:CCGGCATCCTTGTTCCTCAGCAAATCTCGAGATTTGCTGAGGAACAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_145806.2-445s1c1
Sequence:CCGGGCAGGACATGTATCAGTGCTTCTCGAGAAGCACTGATACATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145806.2-705s1c1
Sequence:CCGGGAATACCCTCTACCATCTGCTCTCGAGAGCAGATGGTAGAGGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145806
VALIDATED
ZNF511 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 511
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145806.2-337s1c1
Sequence:CCGGGCACGGAAATGTTTGCTCCTTCTCGAGAAGGAGCAAACATTTCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145806.2-508s1c1
Sequence:CCGGGAAGGATCACATGGTGAGGATCTCGAGATCCTCACCATGTGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_145806.2-689s1c1
Sequence:CCGGCGGATCTACAGACATAGAATACTCGAGTATTCTATGTCTGTAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_145806.2-551s1c1
Sequence:CCGGCGGTTTGATAAGCCAAAGAAACTCGAGTTTCTTTGGCTTATCAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145806.2-908s1c1
Sequence:CCGGGTTCCTCAGCAAATGGCATTACTCGAGTAATGCCATTTGCTGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145806.2-449s1c1
Sequence:CCGGGACATGTATCAGTGCTTGGTACTCGAGTACCAAGCACTGATACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145806.2-550s1c1
Sequence:CCGGCCGGTTTGATAAGCCAAAGAACTCGAGTTCTTTGGCTTATCAAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_145806.2-547s1c1
Sequence:CCGGCTTCCGGTTTGATAAGCCAAACTCGAGTTTGGCTTATCAAACCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145806.2-901s1c1
Sequence:CCGGCATCCTTGTTCCTCAGCAAATCTCGAGATTTGCTGAGGAACAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_145806.2-445s1c1
Sequence:CCGGGCAGGACATGTATCAGTGCTTCTCGAGAAGCACTGATACATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145806.2-705s1c1
Sequence:CCGGGAATACCCTCTACCATCTGCTCTCGAGAGCAGATGGTAGAGGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145806
VALIDATED
ZNF511 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 511
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145806.2-337s1c1
Sequence:CCGGGCACGGAAATGTTTGCTCCTTCTCGAGAAGGAGCAAACATTTCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145806.2-508s1c1
Sequence:CCGGGAAGGATCACATGGTGAGGATCTCGAGATCCTCACCATGTGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_145806.2-689s1c1
Sequence:CCGGCGGATCTACAGACATAGAATACTCGAGTATTCTATGTCTGTAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_145806.2-551s1c1
Sequence:CCGGCGGTTTGATAAGCCAAAGAAACTCGAGTTTCTTTGGCTTATCAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145806.2-908s1c1
Sequence:CCGGGTTCCTCAGCAAATGGCATTACTCGAGTAATGCCATTTGCTGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145806.2-449s1c1
Sequence:CCGGGACATGTATCAGTGCTTGGTACTCGAGTACCAAGCACTGATACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145806.2-550s1c1
Sequence:CCGGCCGGTTTGATAAGCCAAAGAACTCGAGTTCTTTGGCTTATCAAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_145806.2-547s1c1
Sequence:CCGGCTTCCGGTTTGATAAGCCAAACTCGAGTTTGGCTTATCAAACCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145806.2-901s1c1
Sequence:CCGGCATCCTTGTTCCTCAGCAAATCTCGAGATTTGCTGAGGAACAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_145806.2-445s1c1
Sequence:CCGGGCAGGACATGTATCAGTGCTTCTCGAGAAGCACTGATACATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145806.2-705s1c1
Sequence:CCGGGAATACCCTCTACCATCTGCTCTCGAGAGCAGATGGTAGAGGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks