EMAIL THIS PAGE TO A FRIEND

ZNF512

zinc finger protein 512

UniProtKB ID: Q96ME7, B4DSM5, Q53RZ7, Q86XK6, Q96JM0
Gene ID:
Human(84450) Summary: This gene encodes a protein containing four putative zinc finger motifs. Zinc finger motifs may bind to proteins or nucleic acids. Zinc finger-containing proteins are involved in a variety of processes, including regulation of transcription. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Sep 2012]
cow(533884) zinc finger protein 512
sheep(101119194) zinc finger protein 512
domestic guinea pig(100729102) zinc finger protein 512
naked mole-rat(101719789) zinc finger protein 512
Zebrafish(563474) zinc finger protein 512
Horse(100071159) zinc finger protein 512
domestic cat(101095489) zinc finger protein 512
dog(608296) zinc finger protein 512
chicken(769868) zinc finger protein 512
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV30060 Anti-ZNF512 antibody produced in rabbit affinity isolated antibody bovine, rabbit, mouse, guinea pig, human, canine, rat, horse
western blot pricing
HPA031430 Anti-ZNF512 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032434 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078641 MISSION® esiRNA esiRNA human ZNF512 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032434 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207823 predicted 1018
2 SASI_Hs01_00207824 predicted 1444
3 SASI_Hs01_00207825 predicted 1277
4 SASI_Hs01_00207826 predicted 257
5 SASI_Hs01_00207827 predicted 427
6 SASI_Hs01_00207828 predicted 1666
7 SASI_Hs01_00207829 predicted 1776
8 SASI_Hs01_00207830 predicted 245
9 SASI_Hs01_00207831 predicted 1645
10 SASI_Hs01_00207832 predicted 560
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032434
VALIDATED
ZNF512 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 512
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032434.2-1641s1c1
Sequence:CCGGGCTGAGTCTTAGAGTAGGGAACTCGAGTTCCCTACTCTAAGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032434.2-1108s1c1
Sequence:CCGGCGTTCTGCCAAGATAGCTGTACTCGAGTACAGCTATCTTGGCAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032434.2-1201s1c1
Sequence:CCGGGTACCTGATGATCGAAAGTTACTCGAGTAACTTTCGATCATCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136276    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032434.2-3147s1c1
Sequence:CCGGGCTCCTCCAAATAGCTTTAAACTCGAGTTTAAAGCTATTTGGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032434.2-343s1c1
Sequence:CCGGGCTGCTACTTCTCATGTCGAACTCGAGTTCGACATGAGAAGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_032434.2-2037s21c1
Sequence:CCGGTCCCTCTCAAGGCCAACTATACTCGAGTATAGTTGGCCTTGAGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032434.2-564s21c1
Sequence:CCGGGTACTTAGAAATCGTTGATAACTCGAGTTATCAACGATTTCTAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_032434.2-516s21c1
Sequence:CCGGTCGGAAGGAACCACCAGTTTACTCGAGTAAACTGGTGGTTCCTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032434.2-120s21c1
Sequence:CCGGTTCGGGACCCACAACCTTTAACTCGAGTTAAAGGTTGTGGGTCCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032434.2-1108s21c1
Sequence:CCGGCGTTCTGCCAAGATAGCTGTACTCGAGTACAGCTATCTTGGCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032434
VALIDATED
ZNF512 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 512
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032434.2-1641s1c1
Sequence:CCGGGCTGAGTCTTAGAGTAGGGAACTCGAGTTCCCTACTCTAAGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032434.2-1108s1c1
Sequence:CCGGCGTTCTGCCAAGATAGCTGTACTCGAGTACAGCTATCTTGGCAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032434.2-1201s1c1
Sequence:CCGGGTACCTGATGATCGAAAGTTACTCGAGTAACTTTCGATCATCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136276    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032434.2-3147s1c1
Sequence:CCGGGCTCCTCCAAATAGCTTTAAACTCGAGTTTAAAGCTATTTGGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032434.2-343s1c1
Sequence:CCGGGCTGCTACTTCTCATGTCGAACTCGAGTTCGACATGAGAAGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_032434.2-2037s21c1
Sequence:CCGGTCCCTCTCAAGGCCAACTATACTCGAGTATAGTTGGCCTTGAGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032434.2-564s21c1
Sequence:CCGGGTACTTAGAAATCGTTGATAACTCGAGTTATCAACGATTTCTAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_032434.2-516s21c1
Sequence:CCGGTCGGAAGGAACCACCAGTTTACTCGAGTAAACTGGTGGTTCCTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032434.2-120s21c1
Sequence:CCGGTTCGGGACCCACAACCTTTAACTCGAGTTAAAGGTTGTGGGTCCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032434.2-1108s21c1
Sequence:CCGGCGTTCTGCCAAGATAGCTGTACTCGAGTACAGCTATCTTGGCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032434
VALIDATED
ZNF512 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 512
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032434.2-1641s1c1
Sequence:CCGGGCTGAGTCTTAGAGTAGGGAACTCGAGTTCCCTACTCTAAGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032434.2-1108s1c1
Sequence:CCGGCGTTCTGCCAAGATAGCTGTACTCGAGTACAGCTATCTTGGCAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032434.2-1201s1c1
Sequence:CCGGGTACCTGATGATCGAAAGTTACTCGAGTAACTTTCGATCATCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136276    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032434.2-3147s1c1
Sequence:CCGGGCTCCTCCAAATAGCTTTAAACTCGAGTTTAAAGCTATTTGGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032434.2-343s1c1
Sequence:CCGGGCTGCTACTTCTCATGTCGAACTCGAGTTCGACATGAGAAGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_032434.2-2037s21c1
Sequence:CCGGTCCCTCTCAAGGCCAACTATACTCGAGTATAGTTGGCCTTGAGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032434.2-564s21c1
Sequence:CCGGGTACTTAGAAATCGTTGATAACTCGAGTTATCAACGATTTCTAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_032434.2-516s21c1
Sequence:CCGGTCGGAAGGAACCACCAGTTTACTCGAGTAAACTGGTGGTTCCTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032434.2-120s21c1
Sequence:CCGGTTCGGGACCCACAACCTTTAACTCGAGTTAAAGGTTGTGGGTCCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032434.2-1108s21c1
Sequence:CCGGCGTTCTGCCAAGATAGCTGTACTCGAGTACAGCTATCTTGGCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks