EMAIL THIS PAGE TO A FRIEND

ZNF512B

zinc finger protein 512B

Synonyms: GM632
UniProtKB ID: Q96KM6, Q08AK9, Q9ULM4
Gene ID:
Mouse(269401) zinc finger protein 512B
chicken(419255) zinc finger protein 512B
dog(485983) zinc finger protein 512B
domestic cat(101091777) zinc finger protein 512B
naked mole-rat(101700849) zinc finger protein 512B
domestic guinea pig(100715195) zinc finger protein 512B
cow(614014) zinc finger protein 512B
sheep(101108330) zinc finger protein 512B
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_977462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_977462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_977462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020713 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020713 Rosetta Predictions human pricing
XM_977462 Rosetta Predictions mouse pricing
XM_990196 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022672 predicted 889
2 SASI_Hs01_00022674 predicted 1025
3 SASI_Hs02_00353725 predicted 1643
4 SASI_Hs01_00022675 predicted 574
5 SASI_Hs01_00022677 predicted 359
6 SASI_Hs01_00022678 predicted 858
7 SASI_Hs02_00353726 predicted 967
8 SASI_Hs01_00022680 predicted 2434
9 SASI_Hs02_00353727 predicted 815
10 SASI_Hs02_00353728 predicted 626
11 SASI_Hs01_00022673 predicted 409
12 SASI_Hs01_00022676 predicted 1119
13 SASI_Hs01_00022679 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234965 predicted 948
2 SASI_Mm02_00446333 predicted 1344
3 SASI_Mm01_00234966 predicted 834
4 SASI_Mm01_00234967 predicted 3350
5 SASI_Mm02_00446334 predicted 1912
6 SASI_Mm01_00234968 predicted 2865
7 SASI_Mm01_00234969 predicted 2549
8 SASI_Mm01_00234970 predicted 3022
9 SASI_Mm01_00234971 predicted 766
10 SASI_Mm01_00234972 predicted 888
11 SASI_Mm01_00234973 predicted 744
12 SASI_Mm01_00234974 predicted 2599
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_990196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00450188 predicted 942
2 SASI_Mm02_00450189 predicted 1342
3 SASI_Mm02_00450190 predicted 834
4 SASI_Mm02_00450191 predicted 3345
5 SASI_Mm02_00450192 predicted 1919
6 SASI_Mm02_00450193 predicted 2860
7 SASI_Mm02_00450194 predicted 2545
8 SASI_Mm02_00450195 predicted 3026
9 SASI_Mm02_00450196 predicted 769
10 SASI_Mm02_00450197 predicted 887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_977462
VALIDATED
ZNF512B MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 512B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_977462.2-1151s21c1
Sequence:CCGGAGCTGGAGAAGCACCGGATATCTCGAGATATCCGGTGCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_977462.2-2222s21c1
Sequence:CCGGAGTTGCAGGAAGCACTCAAATCTCGAGATTTGAGTGCTTCCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_977462.2-2865s21c1
Sequence:CCGGTGTGAACTGTCCCAATGATTGCTCGAGCAATCATTGGGACAGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_977462.2-956s21c1
Sequence:CCGGATGGGCTCAAGTACCACTATCCTCGAGGATAGTGGTACTTGAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_977462.2-4164s21c1
Sequence:CCGGCTATGCTAGGTGGGCCTATAACTCGAGTTATAGGCCCACCTAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_977462
VALIDATED
ZNF512B MISSION shRNA shRNA Plasmid DNA
zinc finger protein 512B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_977462.2-1151s21c1
Sequence:CCGGAGCTGGAGAAGCACCGGATATCTCGAGATATCCGGTGCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_977462.2-2222s21c1
Sequence:CCGGAGTTGCAGGAAGCACTCAAATCTCGAGATTTGAGTGCTTCCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_977462.2-2865s21c1
Sequence:CCGGTGTGAACTGTCCCAATGATTGCTCGAGCAATCATTGGGACAGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_977462.2-956s21c1
Sequence:CCGGATGGGCTCAAGTACCACTATCCTCGAGGATAGTGGTACTTGAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_977462.2-4164s21c1
Sequence:CCGGCTATGCTAGGTGGGCCTATAACTCGAGTTATAGGCCCACCTAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_977462
VALIDATED
ZNF512B MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 512B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_977462.2-1151s21c1
Sequence:CCGGAGCTGGAGAAGCACCGGATATCTCGAGATATCCGGTGCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_977462.2-2222s21c1
Sequence:CCGGAGTTGCAGGAAGCACTCAAATCTCGAGATTTGAGTGCTTCCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_977462.2-2865s21c1
Sequence:CCGGTGTGAACTGTCCCAATGATTGCTCGAGCAATCATTGGGACAGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_977462.2-956s21c1
Sequence:CCGGATGGGCTCAAGTACCACTATCCTCGAGGATAGTGGTACTTGAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_977462.2-4164s21c1
Sequence:CCGGCTATGCTAGGTGGGCCTATAACTCGAGTTATAGGCCCACCTAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020713
VALIDATED
ZNF512B MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 512B
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020713.1-411s21c1
Sequence:CCGGCTACGGGCTCAAGTACCATTACTCGAGTAATGGTACTTGAGCCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020713.1-863s21c1
Sequence:CCGGTACCTGTCACCAAACCCATTACTCGAGTAATGGGTTTGGTGACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020713.1-5698s21c1
Sequence:CCGGCTATCACTTGTAACCATATATCTCGAGATATATGGTTACAAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020713.1-2435s21c1
Sequence:CCGGGTTCTGAGAGTGGCGTCAAATCTCGAGATTTGACGCCACTCTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020713.1-635s21c1
Sequence:CCGGTGAGCAAACCTGTCACTATTGCTCGAGCAATAGTGACAGGTTTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020713.1-4187s1c1
Sequence:CCGGCCAGTCTTGTTGCTGTGACAACTCGAGTTGTCACAGCAACAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020713.1-5757s1c1
Sequence:CCGGGAGATGTTTCAACGGTGAGTTCTCGAGAACTCACCGTTGAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128958    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020713.1-5414s1c1
Sequence:CCGGGCACTTTATTTGCTGGTGCAACTCGAGTTGCACCAGCAAATAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020713.1-873s1c1
Sequence:CCGGCAAACCCATTACGGTAACAAACTCGAGTTTGTTACCGTAATGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020713.1-2442s1c1
Sequence:CCGGGAGTGGCGTCAAATACCACATCTCGAGATGTGGTATTTGACGCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020713.1-1303s1c1
Sequence:CCGGCGCACAAAGCACAGAAGGAAACTCGAGTTTCCTTCTGTGCTTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020713.1-1690s1c1
Sequence:CCGGCGGAAGCAGTTCAAGTCCAAACTCGAGTTTGGACTTGAACTGCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020713.1-2435s1c1
Sequence:CCGGGTTCTGAGAGTGGCGTCAAATCTCGAGATTTGACGCCACTCTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020713.1-819s1c1
Sequence:CCGGCAAACCCATCACAGTCACCAACTCGAGTTGGTGACTGTGATGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020713
VALIDATED
ZNF512B MISSION shRNA shRNA Plasmid DNA
zinc finger protein 512B
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020713.1-411s21c1
Sequence:CCGGCTACGGGCTCAAGTACCATTACTCGAGTAATGGTACTTGAGCCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020713.1-863s21c1
Sequence:CCGGTACCTGTCACCAAACCCATTACTCGAGTAATGGGTTTGGTGACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020713.1-5698s21c1
Sequence:CCGGCTATCACTTGTAACCATATATCTCGAGATATATGGTTACAAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020713.1-2435s21c1
Sequence:CCGGGTTCTGAGAGTGGCGTCAAATCTCGAGATTTGACGCCACTCTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020713.1-635s21c1
Sequence:CCGGTGAGCAAACCTGTCACTATTGCTCGAGCAATAGTGACAGGTTTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020713.1-4187s1c1
Sequence:CCGGCCAGTCTTGTTGCTGTGACAACTCGAGTTGTCACAGCAACAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020713.1-5757s1c1
Sequence:CCGGGAGATGTTTCAACGGTGAGTTCTCGAGAACTCACCGTTGAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128958    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020713.1-5414s1c1
Sequence:CCGGGCACTTTATTTGCTGGTGCAACTCGAGTTGCACCAGCAAATAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020713.1-873s1c1
Sequence:CCGGCAAACCCATTACGGTAACAAACTCGAGTTTGTTACCGTAATGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020713.1-2442s1c1
Sequence:CCGGGAGTGGCGTCAAATACCACATCTCGAGATGTGGTATTTGACGCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020713.1-1303s1c1
Sequence:CCGGCGCACAAAGCACAGAAGGAAACTCGAGTTTCCTTCTGTGCTTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020713.1-1690s1c1
Sequence:CCGGCGGAAGCAGTTCAAGTCCAAACTCGAGTTTGGACTTGAACTGCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020713.1-2435s1c1
Sequence:CCGGGTTCTGAGAGTGGCGTCAAATCTCGAGATTTGACGCCACTCTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020713.1-819s1c1
Sequence:CCGGCAAACCCATCACAGTCACCAACTCGAGTTGGTGACTGTGATGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020713
VALIDATED
ZNF512B MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 512B
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020713.1-411s21c1
Sequence:CCGGCTACGGGCTCAAGTACCATTACTCGAGTAATGGTACTTGAGCCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020713.1-863s21c1
Sequence:CCGGTACCTGTCACCAAACCCATTACTCGAGTAATGGGTTTGGTGACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020713.1-5698s21c1
Sequence:CCGGCTATCACTTGTAACCATATATCTCGAGATATATGGTTACAAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020713.1-2435s21c1
Sequence:CCGGGTTCTGAGAGTGGCGTCAAATCTCGAGATTTGACGCCACTCTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020713.1-635s21c1
Sequence:CCGGTGAGCAAACCTGTCACTATTGCTCGAGCAATAGTGACAGGTTTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020713.1-4187s1c1
Sequence:CCGGCCAGTCTTGTTGCTGTGACAACTCGAGTTGTCACAGCAACAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020713.1-5757s1c1
Sequence:CCGGGAGATGTTTCAACGGTGAGTTCTCGAGAACTCACCGTTGAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128958    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020713.1-5414s1c1
Sequence:CCGGGCACTTTATTTGCTGGTGCAACTCGAGTTGCACCAGCAAATAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020713.1-873s1c1
Sequence:CCGGCAAACCCATTACGGTAACAAACTCGAGTTTGTTACCGTAATGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020713.1-2442s1c1
Sequence:CCGGGAGTGGCGTCAAATACCACATCTCGAGATGTGGTATTTGACGCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020713.1-1303s1c1
Sequence:CCGGCGCACAAAGCACAGAAGGAAACTCGAGTTTCCTTCTGTGCTTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020713.1-1690s1c1
Sequence:CCGGCGGAAGCAGTTCAAGTCCAAACTCGAGTTTGGACTTGAACTGCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020713.1-2435s1c1
Sequence:CCGGGTTCTGAGAGTGGCGTCAAATCTCGAGATTTGACGCCACTCTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020713.1-819s1c1
Sequence:CCGGCAAACCCATCACAGTCACCAACTCGAGTTGGTGACTGTGATGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks