EMAIL THIS PAGE TO A FRIEND

ZNF513

zinc finger protein 513

Synonyms: HMFT0656 RP58
Gene ID:
Human(130557) Summary: The protein encoded by this gene is a possible transcriptional regulator involved in retinal development. Defects in this gene can be a cause of autosomal-recessive retinitis pigmentosa. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
cow(100138621) zinc finger protein 513
sheep(101117741) zinc finger protein 513
domestic guinea pig(100730003) zinc finger protein 513
naked mole-rat(101713888) zinc finger protein 513
Domestic Rabbit(100349477) zinc finger protein 513
Zebrafish(568216) zinc finger protein 513
Horse(100071202) zinc finger protein 513
domestic cat(101098705) zinc finger protein 513
dog(483012) zinc finger protein 513
chicken(421989) zinc finger protein 513
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144631 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149171 MISSION® esiRNA esiRNA human ZNF513 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144631 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232329 predicted 1550
2 SASI_Hs01_00232331 predicted 1044
3 SASI_Hs01_00232332 predicted 1268
4 SASI_Hs01_00232333 predicted 473
5 SASI_Hs01_00232334 predicted 1370
6 SASI_Hs01_00232335 predicted 1386
7 SASI_Hs01_00232336 predicted 1470
8 SASI_Hs02_00364463 predicted 361
9 SASI_Hs02_00364464 predicted 492
10 SASI_Hs02_00364465 predicted 1524
11 SASI_Hs01_00232327 predicted 377
12 SASI_Hs01_00232328 predicted 1478
13 SASI_Hs01_00232330 predicted 1459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144631
VALIDATED
ZNF513 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 513
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144631.3-309s1c1
Sequence:CCGGGATTTGCTACTAGGCCAGGATCTCGAGATCCTGGCCTAGTAGCAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144631.3-1011s1c1
Sequence:CCGGCTTCCAGATTTGAGCCTCCATCTCGAGATGGAGGCTCAAATCTGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1463s21c1
Sequence:CCGGCCCTTATGCCTGTGGCAATCTCTCGAGAGATTGCCACAGGCATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1505s21c1
Sequence:CCGGTCGCATCCACTCTGGTGACAACTCGAGTTGTCACCAGAGTGGATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1561s21c1
Sequence:CCGGACCAGAGCATGAACCTCAAACCTCGAGGTTTGAGGTTCATGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_144631.4-1393s21c1
Sequence:CCGGCTCATCTGGATAACCTGAAACCTCGAGGTTTCAGGTTATCCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_144631.4-1115s21c1
Sequence:CCGGACCACTGCCAGAGCTGCTATTCTCGAGAATAGCAGCTCTGGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_144631.4-770s21c1
Sequence:CCGGCGTCAACCTGACACGACATACCTCGAGGTATGTCGTGTCAGGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-293s21c1
Sequence:CCGGCCTGGTATTGGAGAGTGATTTCTCGAGAAATCACTCTCCAATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1738s21c1
Sequence:CCGGCTCATAGCCCACCCTCTGTTTCTCGAGAAACAGAGGGTGGGCTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144631.4-1896s21c1
Sequence:CCGGGGGCTCCACACAGACTAACGTCTCGAGACGTTAGTCTGTGTGGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144631.4-1851s21c1
Sequence:CCGGTATACAGACGGACCAGAAGCCCTCGAGGGCTTCTGGTCCGTCTGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1380s21c1
Sequence:CCGGCCTTATGCCTCTGCTCATCTGCTCGAGCAGATGAGCAGAGGCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-480s21c1
Sequence:CCGGGCACTAAGTGCGGAGAGTGAACTCGAGTTCACTCTCCGCACTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144631.4-1907s21c1
Sequence:CCGGAGACTAACGTAGGCACTATAACTCGAGTTATAGTGCCTACGTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1818s21c1
Sequence:CCGGTCATCCTGAACTAGGTCCTTCCTCGAGGAAGGACCTAGTTCAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144631
VALIDATED
ZNF513 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 513
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144631.3-309s1c1
Sequence:CCGGGATTTGCTACTAGGCCAGGATCTCGAGATCCTGGCCTAGTAGCAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144631.3-1011s1c1
Sequence:CCGGCTTCCAGATTTGAGCCTCCATCTCGAGATGGAGGCTCAAATCTGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1463s21c1
Sequence:CCGGCCCTTATGCCTGTGGCAATCTCTCGAGAGATTGCCACAGGCATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1505s21c1
Sequence:CCGGTCGCATCCACTCTGGTGACAACTCGAGTTGTCACCAGAGTGGATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1561s21c1
Sequence:CCGGACCAGAGCATGAACCTCAAACCTCGAGGTTTGAGGTTCATGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_144631.4-1393s21c1
Sequence:CCGGCTCATCTGGATAACCTGAAACCTCGAGGTTTCAGGTTATCCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_144631.4-1115s21c1
Sequence:CCGGACCACTGCCAGAGCTGCTATTCTCGAGAATAGCAGCTCTGGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_144631.4-770s21c1
Sequence:CCGGCGTCAACCTGACACGACATACCTCGAGGTATGTCGTGTCAGGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-293s21c1
Sequence:CCGGCCTGGTATTGGAGAGTGATTTCTCGAGAAATCACTCTCCAATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1738s21c1
Sequence:CCGGCTCATAGCCCACCCTCTGTTTCTCGAGAAACAGAGGGTGGGCTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144631.4-1896s21c1
Sequence:CCGGGGGCTCCACACAGACTAACGTCTCGAGACGTTAGTCTGTGTGGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144631.4-1851s21c1
Sequence:CCGGTATACAGACGGACCAGAAGCCCTCGAGGGCTTCTGGTCCGTCTGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1380s21c1
Sequence:CCGGCCTTATGCCTCTGCTCATCTGCTCGAGCAGATGAGCAGAGGCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-480s21c1
Sequence:CCGGGCACTAAGTGCGGAGAGTGAACTCGAGTTCACTCTCCGCACTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144631.4-1907s21c1
Sequence:CCGGAGACTAACGTAGGCACTATAACTCGAGTTATAGTGCCTACGTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1818s21c1
Sequence:CCGGTCATCCTGAACTAGGTCCTTCCTCGAGGAAGGACCTAGTTCAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144631
VALIDATED
ZNF513 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 513
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144631.3-309s1c1
Sequence:CCGGGATTTGCTACTAGGCCAGGATCTCGAGATCCTGGCCTAGTAGCAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144631.3-1011s1c1
Sequence:CCGGCTTCCAGATTTGAGCCTCCATCTCGAGATGGAGGCTCAAATCTGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1463s21c1
Sequence:CCGGCCCTTATGCCTGTGGCAATCTCTCGAGAGATTGCCACAGGCATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1505s21c1
Sequence:CCGGTCGCATCCACTCTGGTGACAACTCGAGTTGTCACCAGAGTGGATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1561s21c1
Sequence:CCGGACCAGAGCATGAACCTCAAACCTCGAGGTTTGAGGTTCATGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_144631.4-1393s21c1
Sequence:CCGGCTCATCTGGATAACCTGAAACCTCGAGGTTTCAGGTTATCCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_144631.4-1115s21c1
Sequence:CCGGACCACTGCCAGAGCTGCTATTCTCGAGAATAGCAGCTCTGGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_144631.4-770s21c1
Sequence:CCGGCGTCAACCTGACACGACATACCTCGAGGTATGTCGTGTCAGGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-293s21c1
Sequence:CCGGCCTGGTATTGGAGAGTGATTTCTCGAGAAATCACTCTCCAATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1738s21c1
Sequence:CCGGCTCATAGCCCACCCTCTGTTTCTCGAGAAACAGAGGGTGGGCTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144631.4-1896s21c1
Sequence:CCGGGGGCTCCACACAGACTAACGTCTCGAGACGTTAGTCTGTGTGGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144631.4-1851s21c1
Sequence:CCGGTATACAGACGGACCAGAAGCCCTCGAGGGCTTCTGGTCCGTCTGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1380s21c1
Sequence:CCGGCCTTATGCCTCTGCTCATCTGCTCGAGCAGATGAGCAGAGGCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-480s21c1
Sequence:CCGGGCACTAAGTGCGGAGAGTGAACTCGAGTTCACTCTCCGCACTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144631.4-1907s21c1
Sequence:CCGGAGACTAACGTAGGCACTATAACTCGAGTTATAGTGCCTACGTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144631.4-1818s21c1
Sequence:CCGGTCATCCTGAACTAGGTCCTTCCTCGAGGAAGGACCTAGTTCAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks