EMAIL THIS PAGE TO A FRIEND

ZNF514

zinc finger protein 514

UniProtKB ID: Q96K75, Q5JPJ3
Gene ID:
dog(611670) zinc finger protein 514
Horse(100063072) zinc finger protein 514
domestic cat(101089433) zinc finger protein 514
naked mole-rat(101716578) zinc finger protein 514
cow(782049) zinc finger protein 514
sheep(101115269) zinc finger protein 514
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032788 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032788 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032788 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044231 MISSION® esiRNA esiRNA human ZNF514 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032788 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188491 predicted 486
2 SASI_Hs01_00188492 predicted 1268
3 SASI_Hs02_00360345 predicted 735
4 SASI_Hs01_00188493 predicted 1002
5 SASI_Hs01_00188494 predicted 914
6 SASI_Hs01_00188495 predicted 1184
7 SASI_Hs01_00188498 predicted 507
8 SASI_Hs01_00188499 predicted 855
9 SASI_Hs01_00188500 predicted 1202
10 SASI_Hs02_00360346 predicted 955
11 SASI_Hs01_00188496 predicted 782
12 SASI_Hs01_00188497 predicted 820
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032788
ZNF514 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 514
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000016828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032788.1-613s1c1
Sequence:CCGGCCAAGGAATCAATGCCAAGTTCTCGAGAACTTGGCATTGATTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032788.1-1267s1c1
Sequence:CCGGGTCACACTTCATCCCTTATTACTCGAGTAATAAGGGATGAAGTGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032788.1-492s1c1
Sequence:CCGGCTGGGCCTTCTAGTATCCAAACTCGAGTTTGGATACTAGAAGGCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032788.1-1519s1c1
Sequence:CCGGCTCATACTGCATCCCTTATTACTCGAGTAATAAGGGATGCAGTATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032788
ZNF514 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 514
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000016828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032788.1-613s1c1
Sequence:CCGGCCAAGGAATCAATGCCAAGTTCTCGAGAACTTGGCATTGATTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032788.1-1267s1c1
Sequence:CCGGGTCACACTTCATCCCTTATTACTCGAGTAATAAGGGATGAAGTGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032788.1-492s1c1
Sequence:CCGGCTGGGCCTTCTAGTATCCAAACTCGAGTTTGGATACTAGAAGGCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032788.1-1519s1c1
Sequence:CCGGCTCATACTGCATCCCTTATTACTCGAGTAATAAGGGATGCAGTATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032788
ZNF514 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 514
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000016828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032788.1-613s1c1
Sequence:CCGGCCAAGGAATCAATGCCAAGTTCTCGAGAACTTGGCATTGATTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032788.1-1267s1c1
Sequence:CCGGGTCACACTTCATCCCTTATTACTCGAGTAATAAGGGATGAAGTGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032788.1-492s1c1
Sequence:CCGGCTGGGCCTTCTAGTATCCAAACTCGAGTTTGGATACTAGAAGGCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032788.1-1519s1c1
Sequence:CCGGCTCATACTGCATCCCTTATTACTCGAGTAATAAGGGATGCAGTATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks