EMAIL THIS PAGE TO A FRIEND

ZNF516

zinc finger protein 516

Synonyms: HsT287
UniProtKB ID: Q92618
Gene ID:
Human(9658) Summary: Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This gene encodes a zinc-finger protein, and belongs to the krueppel C2H2-type zinc-finger protein family. It may be involved in transcriptional regulation. [provided by RefSeq, Sep 2012]
cow(519449) zinc finger protein 516
sheep(101109931) zinc finger protein 516
naked mole-rat(101703915) zinc finger protein 516
Domestic Rabbit(100345990) zinc finger protein 516
domestic guinea pig(100731703) zinc finger protein 516
Zebrafish(566898) zinc finger protein 516
dog(483930) zinc finger protein 516
chicken(421009) zinc finger protein 516
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014643 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014643 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014643 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021871 MISSION® esiRNA esiRNA human ZNF516 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014643 Rosetta Predictions human pricing
XM_496278 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345955 predicted 2365
2 SASI_Hs02_00345956 predicted 2612
3 SASI_Hs02_00345957 predicted 2812
4 SASI_Hs02_00345958 predicted 1791
5 SASI_Hs02_00345959 predicted 3517
6 SASI_Hs02_00345960 predicted 2123
7 SASI_Hs02_00345961 predicted 3158
8 SASI_Hs02_00345962 predicted 3702
9 SASI_Hs02_00345963 predicted 2492
10 SASI_Hs02_00345964 predicted 3759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266328 predicted 2649
2 SASI_Hs01_00266329 predicted 2889
3 SASI_Hs01_00266330 predicted 2390
4 SASI_Hs01_00266331 predicted 2071
5 SASI_Hs01_00266332 predicted 3803
6 SASI_Hs01_00266333 predicted 3004
7 SASI_Hs01_00266334 predicted 2401
8 SASI_Hs01_00266335 predicted 2532
9 SASI_Hs01_00266336 predicted 2775
10 SASI_Hs01_00266337 predicted 4046
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014643
ZNF516 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 516
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014643.2-2814s21c1
Sequence:CCGGCCGCTAGCATGCCTAAGAATACTCGAGTATTCTTAGGCATGCTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014643.2-2419s21c1
Sequence:CCGGAGACCTCATGCCGCTAGATTTCTCGAGAAATCTAGCGGCATGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014643.2-3718s21c1
Sequence:CCGGGGGAACCTAAAGGCGTGTTTCCTCGAGGAAACACGCCTTTAGGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014643.2-3411s21c1
Sequence:CCGGACATCTTTAAGACGTACATTCCTCGAGGAATGTACGTCTTAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014643.2-3989s21c1
Sequence:CCGGATCGTCCATAGTCCCATATTTCTCGAGAAATATGGGACTATGGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014643
ZNF516 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 516
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014643.2-2814s21c1
Sequence:CCGGCCGCTAGCATGCCTAAGAATACTCGAGTATTCTTAGGCATGCTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014643.2-2419s21c1
Sequence:CCGGAGACCTCATGCCGCTAGATTTCTCGAGAAATCTAGCGGCATGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014643.2-3718s21c1
Sequence:CCGGGGGAACCTAAAGGCGTGTTTCCTCGAGGAAACACGCCTTTAGGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014643.2-3411s21c1
Sequence:CCGGACATCTTTAAGACGTACATTCCTCGAGGAATGTACGTCTTAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014643.2-3989s21c1
Sequence:CCGGATCGTCCATAGTCCCATATTTCTCGAGAAATATGGGACTATGGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014643
ZNF516 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 516
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014643.2-2814s21c1
Sequence:CCGGCCGCTAGCATGCCTAAGAATACTCGAGTATTCTTAGGCATGCTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014643.2-2419s21c1
Sequence:CCGGAGACCTCATGCCGCTAGATTTCTCGAGAAATCTAGCGGCATGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014643.2-3718s21c1
Sequence:CCGGGGGAACCTAAAGGCGTGTTTCCTCGAGGAAACACGCCTTTAGGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014643.2-3411s21c1
Sequence:CCGGACATCTTTAAGACGTACATTCCTCGAGGAATGTACGTCTTAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014643.2-3989s21c1
Sequence:CCGGATCGTCCATAGTCCCATATTTCTCGAGAAATATGGGACTATGGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks