EMAIL THIS PAGE TO A FRIEND

ZNF517

zinc finger protein 517

UniProtKB ID: Q6ZMY9
Gene ID:
chicken(431266) zinc finger protein 517
domestic cat(101098437) zinc finger protein 517
dog(482106) zinc finger protein 517
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_291261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_291261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_291261 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_213605 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374284 predicted 1665
2 SASI_Hs02_00374285 predicted 1779
3 SASI_Hs01_00122209 predicted 258
4 SASI_Hs01_00122210 predicted 1407
5 SASI_Hs02_00374286 predicted 260
6 SASI_Hs01_00122213 predicted 285
7 SASI_Hs02_00374287 predicted 1604
8 SASI_Hs02_00374288 predicted 1704
9 SASI_Hs01_00122216 predicted 754
10 SASI_Hs01_00122217 predicted 991
11 SASI_Hs01_00122211 predicted 409
12 SASI_Hs01_00122212 predicted 525
13 SASI_Hs01_00122214 predicted 363
14 SASI_Hs01_00122215 predicted 527
15 SASI_Hs01_00122218 predicted 591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_291261
ZNF517 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 517
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_291261.1-3035s1c1
Sequence:CCGGAGGTGCTGTAAAGCCGACTAACTCGAGTTAGTCGGCTTTACAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291261.1-1700s1c1
Sequence:CCGGGCTGCTTCTCAGGCACCAGATCTCGAGATCTGGTGCCTGAGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291261.1-2369s1c1
Sequence:CCGGGCACCAGAAGATCCACACCAACTCGAGTTGGTGTGGATCTTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291261.1-1802s1c1
Sequence:CCGGGCTGATCCACACTGAGGAGAACTCGAGTTCTCCTCAGTGTGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291261.1-2291s1c1
Sequence:CCGGGCGCCTACACACGGGCGAGAACTCGAGTTCTCGCCCGTGTGTAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_291261
ZNF517 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 517
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_291261.1-3035s1c1
Sequence:CCGGAGGTGCTGTAAAGCCGACTAACTCGAGTTAGTCGGCTTTACAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291261.1-1700s1c1
Sequence:CCGGGCTGCTTCTCAGGCACCAGATCTCGAGATCTGGTGCCTGAGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291261.1-2369s1c1
Sequence:CCGGGCACCAGAAGATCCACACCAACTCGAGTTGGTGTGGATCTTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291261.1-1802s1c1
Sequence:CCGGGCTGATCCACACTGAGGAGAACTCGAGTTCTCCTCAGTGTGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291261.1-2291s1c1
Sequence:CCGGGCGCCTACACACGGGCGAGAACTCGAGTTCTCGCCCGTGTGTAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_291261
ZNF517 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 517
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_291261.1-3035s1c1
Sequence:CCGGAGGTGCTGTAAAGCCGACTAACTCGAGTTAGTCGGCTTTACAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291261.1-1700s1c1
Sequence:CCGGGCTGCTTCTCAGGCACCAGATCTCGAGATCTGGTGCCTGAGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291261.1-2369s1c1
Sequence:CCGGGCACCAGAAGATCCACACCAACTCGAGTTGGTGTGGATCTTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291261.1-1802s1c1
Sequence:CCGGGCTGATCCACACTGAGGAGAACTCGAGTTCTCCTCAGTGTGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291261.1-2291s1c1
Sequence:CCGGGCGCCTACACACGGGCGAGAACTCGAGTTCTCGCCCGTGTGTAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks