EMAIL THIS PAGE TO A FRIEND

ZNF518A

zinc finger protein 518A

Synonyms: ZNF518
UniProtKB ID: Q6AHZ1, A0PJI5, O15044, Q32MP4
Gene ID:
Human(9849) Summary: The protein encoded by this gene is a member of the krueppel C2H2-type zinc finger protein family. The encoded protein contains five zinc fingers and is likely a nuclear transcriptional regulator. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
chicken(428964) zinc finger protein 518A
Horse(100061148) zinc finger protein 518A
domestic cat(101091900) zinc finger protein 518A
dog(100687589) zinc finger protein 518A
domestic guinea pig(100717715) zinc finger protein 518A
naked mole-rat(101717024) zinc finger protein 518A
cow(524691) zinc finger protein 518A
sheep(101110983) zinc finger protein 518A
151 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA029049 Anti-ZNF518A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014803 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014803 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014803 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014803 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346317 predicted 2924
2 SASI_Hs01_00173236 predicted 2083
3 SASI_Hs01_00173237 predicted 3859
4 SASI_Hs01_00173238 predicted 2515
5 SASI_Hs01_00173239 predicted 1283
6 SASI_Hs02_00346318 predicted 3133
7 SASI_Hs02_00346319 predicted 1306
8 SASI_Hs01_00173240 predicted 2877
9 SASI_Hs01_00173241 predicted 970
10 SASI_Hs02_00346320 predicted 4861
11 SASI_Hs01_00173242 predicted 1415
12 SASI_Hs01_00173243 predicted 1184
13 SASI_Hs01_00173244 predicted 2182
14 SASI_Hs01_00173245 predicted 5236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014803
VALIDATED
ZNF518A MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 518A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014803.2-4839s1c1
Sequence:CCGGCCATCAGAACTTTGCGGCTTTCTCGAGAAAGCCGCAAAGTTCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_014803.2-5539s1c1
Sequence:CCGGGCACAGAAGTACCTTGATTTACTCGAGTAAATCAAGGTACTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014803.2-3208s1c1
Sequence:CCGGGCCACCTGAAGTAAACCAATTCTCGAGAATTGGTTTACTTCAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014803.2-3718s1c1
Sequence:CCGGGCTACCAGTTATTCCTGGAAACTCGAGTTTCCAGGAATAACTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014803.2-7030s1c1
Sequence:CCGGGCCATACATAGAATGCTTCAACTCGAGTTGAAGCATTCTATGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014803.2-3551s1c1
Sequence:CCGGGCGATAATAACACAGCAGCTTCTCGAGAAGCTGCTGTGTTATTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014803.2-5300s1c1
Sequence:CCGGCGGGATTGGAACATGTTAGAACTCGAGTTCTAACATGTTCCAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014803.2-2358s1c1
Sequence:CCGGCAGGAGTAACAACTGAGTTAACTCGAGTTAACTCAGTTGTTACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_014803.2-1300s1c1
Sequence:CCGGCCATGGCGAATTACCTTCATACTCGAGTATGAAGGTAATTCGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014803
VALIDATED
ZNF518A MISSION shRNA shRNA Plasmid DNA
zinc finger protein 518A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014803.2-4839s1c1
Sequence:CCGGCCATCAGAACTTTGCGGCTTTCTCGAGAAAGCCGCAAAGTTCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_014803.2-5539s1c1
Sequence:CCGGGCACAGAAGTACCTTGATTTACTCGAGTAAATCAAGGTACTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014803.2-3208s1c1
Sequence:CCGGGCCACCTGAAGTAAACCAATTCTCGAGAATTGGTTTACTTCAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014803.2-3718s1c1
Sequence:CCGGGCTACCAGTTATTCCTGGAAACTCGAGTTTCCAGGAATAACTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014803.2-7030s1c1
Sequence:CCGGGCCATACATAGAATGCTTCAACTCGAGTTGAAGCATTCTATGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014803.2-3551s1c1
Sequence:CCGGGCGATAATAACACAGCAGCTTCTCGAGAAGCTGCTGTGTTATTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014803.2-5300s1c1
Sequence:CCGGCGGGATTGGAACATGTTAGAACTCGAGTTCTAACATGTTCCAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014803.2-2358s1c1
Sequence:CCGGCAGGAGTAACAACTGAGTTAACTCGAGTTAACTCAGTTGTTACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_014803.2-1300s1c1
Sequence:CCGGCCATGGCGAATTACCTTCATACTCGAGTATGAAGGTAATTCGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014803
VALIDATED
ZNF518A MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 518A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014803.2-4839s1c1
Sequence:CCGGCCATCAGAACTTTGCGGCTTTCTCGAGAAAGCCGCAAAGTTCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_014803.2-5539s1c1
Sequence:CCGGGCACAGAAGTACCTTGATTTACTCGAGTAAATCAAGGTACTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014803.2-3208s1c1
Sequence:CCGGGCCACCTGAAGTAAACCAATTCTCGAGAATTGGTTTACTTCAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014803.2-3718s1c1
Sequence:CCGGGCTACCAGTTATTCCTGGAAACTCGAGTTTCCAGGAATAACTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014803.2-7030s1c1
Sequence:CCGGGCCATACATAGAATGCTTCAACTCGAGTTGAAGCATTCTATGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014803.2-3551s1c1
Sequence:CCGGGCGATAATAACACAGCAGCTTCTCGAGAAGCTGCTGTGTTATTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014803.2-5300s1c1
Sequence:CCGGCGGGATTGGAACATGTTAGAACTCGAGTTCTAACATGTTCCAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014803.2-2358s1c1
Sequence:CCGGCAGGAGTAACAACTGAGTTAACTCGAGTTAACTCAGTTGTTACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_014803.2-1300s1c1
Sequence:CCGGCCATGGCGAATTACCTTCATACTCGAGTATGAAGGTAATTCGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks