EMAIL THIS PAGE TO A FRIEND

ZNF518B

zinc finger protein 518B

UniProtKB ID: Q9C0D4, Q96LN8
Gene ID:
cow(539006) zinc finger protein 518B
sheep(101104662) zinc finger protein 518B
naked mole-rat(101700897) zinc finger protein 518B
Domestic Rabbit(100343377) zinc finger protein 518B
domestic guinea pig(100728590) zinc finger protein 518B
chicken(422841) zinc finger protein 518B
dog(479092) zinc finger protein 518B
Horse(100056132) zinc finger protein 518B
domestic cat(101089860) zinc finger protein 518B
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053042 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004401 MISSION® esiRNA esiRNA targeting human ZNF518B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053042 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361866 predicted 1320
2 SASI_Hs01_00077938 predicted 1499
3 SASI_Hs01_00077940 predicted 3432
4 SASI_Hs02_00361867 predicted 2436
5 SASI_Hs01_00077942 predicted 3264
6 SASI_Hs01_00077943 predicted 3331
7 SASI_Hs02_00361868 predicted 2769
8 SASI_Hs01_00077945 predicted 1382
9 SASI_Hs01_00077946 predicted 1609
10 SASI_Hs01_00077947 predicted 1617
11 SASI_Hs01_00077939 predicted 1114
12 SASI_Hs01_00077941 predicted 2435
13 SASI_Hs01_00077944 predicted 3357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053042
VALIDATED
ZNF518B MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 518B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_053042.2-1384s1c1
Sequence:CCGGGCCAAATGAAGTCAACCTATTCTCGAGAATAGGTTGACTTCATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053042.2-4517s1c1
Sequence:CCGGCCAGAAACATAAGTGACCAATCTCGAGATTGGTCACTTATGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053042.2-531s1c1
Sequence:CCGGGCGGACATAATTCCTTGACCACTCGAGTGGTCAAGGAATTATGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053042.2-2847s1c1
Sequence:CCGGCCCACATCATAGAGGCTACATCTCGAGATGTAGCCTCTATGATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053042.2-584s1c1
Sequence:CCGGCCTCGGCCAAATAGACAAGAACTCGAGTTCTTGTCTATTTGGCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053042.2-4926s1c1
Sequence:CCGGCGCTGTTTCTAATTTGTCTTACTCGAGTAAGACAAATTAGAAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053042.2-2668s21c1
Sequence:CCGGTCCGAATGATGGTGGTATTACCTCGAGGTAATACCACCATCATTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053042.2-2261s21c1
Sequence:CCGGCAACATAAGAGTGAGTATTTACTCGAGTAAATACTCACTCTTATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053042.2-520s21c1
Sequence:CCGGACACTTGAACGGCGGACATAACTCGAGTTATGTCCGCCGTTCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053042.2-2141s21c1
Sequence:GTACCGGGACTTGGAATCTACAAGTAAACTCGAGTTTACTTGTAGATTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053042.2-4321s21c1
Sequence:CCGGTCAACTGCTTGCCTGAATTTACTCGAGTAAATTCAGGCAAGCAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053042
VALIDATED
ZNF518B MISSION shRNA shRNA Plasmid DNA
zinc finger protein 518B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_053042.2-1384s1c1
Sequence:CCGGGCCAAATGAAGTCAACCTATTCTCGAGAATAGGTTGACTTCATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053042.2-4517s1c1
Sequence:CCGGCCAGAAACATAAGTGACCAATCTCGAGATTGGTCACTTATGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053042.2-531s1c1
Sequence:CCGGGCGGACATAATTCCTTGACCACTCGAGTGGTCAAGGAATTATGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053042.2-2847s1c1
Sequence:CCGGCCCACATCATAGAGGCTACATCTCGAGATGTAGCCTCTATGATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053042.2-584s1c1
Sequence:CCGGCCTCGGCCAAATAGACAAGAACTCGAGTTCTTGTCTATTTGGCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053042.2-4926s1c1
Sequence:CCGGCGCTGTTTCTAATTTGTCTTACTCGAGTAAGACAAATTAGAAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053042.2-2668s21c1
Sequence:CCGGTCCGAATGATGGTGGTATTACCTCGAGGTAATACCACCATCATTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053042.2-2261s21c1
Sequence:CCGGCAACATAAGAGTGAGTATTTACTCGAGTAAATACTCACTCTTATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053042.2-520s21c1
Sequence:CCGGACACTTGAACGGCGGACATAACTCGAGTTATGTCCGCCGTTCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053042.2-2141s21c1
Sequence:GTACCGGGACTTGGAATCTACAAGTAAACTCGAGTTTACTTGTAGATTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053042.2-4321s21c1
Sequence:CCGGTCAACTGCTTGCCTGAATTTACTCGAGTAAATTCAGGCAAGCAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053042
VALIDATED
ZNF518B MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 518B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_053042.2-1384s1c1
Sequence:CCGGGCCAAATGAAGTCAACCTATTCTCGAGAATAGGTTGACTTCATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053042.2-4517s1c1
Sequence:CCGGCCAGAAACATAAGTGACCAATCTCGAGATTGGTCACTTATGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053042.2-531s1c1
Sequence:CCGGGCGGACATAATTCCTTGACCACTCGAGTGGTCAAGGAATTATGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053042.2-2847s1c1
Sequence:CCGGCCCACATCATAGAGGCTACATCTCGAGATGTAGCCTCTATGATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053042.2-584s1c1
Sequence:CCGGCCTCGGCCAAATAGACAAGAACTCGAGTTCTTGTCTATTTGGCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053042.2-4926s1c1
Sequence:CCGGCGCTGTTTCTAATTTGTCTTACTCGAGTAAGACAAATTAGAAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053042.2-2668s21c1
Sequence:CCGGTCCGAATGATGGTGGTATTACCTCGAGGTAATACCACCATCATTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053042.2-2261s21c1
Sequence:CCGGCAACATAAGAGTGAGTATTTACTCGAGTAAATACTCACTCTTATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053042.2-520s21c1
Sequence:CCGGACACTTGAACGGCGGACATAACTCGAGTTATGTCCGCCGTTCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053042.2-2141s21c1
Sequence:GTACCGGGACTTGGAATCTACAAGTAAACTCGAGTTTACTTGTAGATTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053042.2-4321s21c1
Sequence:CCGGTCAACTGCTTGCCTGAATTTACTCGAGTAAATTCAGGCAAGCAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks