EMAIL THIS PAGE TO A FRIEND

ZNF519

zinc finger protein 519

Synonyms: HsT2362
Species: Human ZNF519(162655)
UniProtKB ID: Q8TB69
Gene ID:
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145287 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145287 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145287 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046641 MISSION® esiRNA esiRNA human ZNF519 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145287 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164356 predicted 324
2 SASI_Hs01_00164357 predicted 467
3 SASI_Hs01_00164358 predicted 980
4 SASI_Hs01_00164360 predicted 281
5 SASI_Hs01_00164361 predicted 791
6 SASI_Hs01_00164363 predicted 880
7 SASI_Hs01_00164364 predicted 450
8 SASI_Hs01_00164365 predicted 468
9 SASI_Hs02_00365169 predicted 430
10 SASI_Hs02_00365170 predicted 900
11 SASI_Hs01_00164359 predicted 502
12 SASI_Hs01_00164362 predicted 549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145287
VALIDATED
ZNF519 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 519
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145287.2-774s21c1
Sequence:CCGGGCCTTACAACTCTAATGAATGCTCGAGCATTCATTAGAGTTGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145287.2-900s21c1
Sequence:CCGGATCACATCTAAAGGGACATAACTCGAGTTATGTCCCTTTAGATGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145287.2-322s21c1
Sequence:CCGGCAAGGCATACAAGATTCATTCCTCGAGGAATGAATCTTGTATGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145287.2-1760s21c1
Sequence:CCGGTAATTCATACCAGGTAGAAACCTCGAGGTTTCTACCTGGTATGAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145287.1-557s1c1
Sequence:CCGGGCTCCTACAGAACCATGTATTCTCGAGAATACATGGTTCTGTAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145287.1-646s1c1
Sequence:CCGGCCATGACTCAGATATTAGTAACTCGAGTTACTAATATCTGAGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145287.1-815s1c1
Sequence:CCGGCCATTCTCAAAGCTTACTCAACTCGAGTTGAGTAAGCTTTGAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145287.1-282s1c1
Sequence:CCGGCCCTGGCTGTGTATTCTTATTCTCGAGAATAAGAATACACAGCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145287.1-1663s1c1
Sequence:CCGGCCTTACTCAACATCAGAGAATCTCGAGATTCTCTGATGTTGAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145287
VALIDATED
ZNF519 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 519
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145287.2-774s21c1
Sequence:CCGGGCCTTACAACTCTAATGAATGCTCGAGCATTCATTAGAGTTGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145287.2-900s21c1
Sequence:CCGGATCACATCTAAAGGGACATAACTCGAGTTATGTCCCTTTAGATGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145287.2-322s21c1
Sequence:CCGGCAAGGCATACAAGATTCATTCCTCGAGGAATGAATCTTGTATGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145287.2-1760s21c1
Sequence:CCGGTAATTCATACCAGGTAGAAACCTCGAGGTTTCTACCTGGTATGAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145287.1-557s1c1
Sequence:CCGGGCTCCTACAGAACCATGTATTCTCGAGAATACATGGTTCTGTAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145287.1-646s1c1
Sequence:CCGGCCATGACTCAGATATTAGTAACTCGAGTTACTAATATCTGAGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145287.1-815s1c1
Sequence:CCGGCCATTCTCAAAGCTTACTCAACTCGAGTTGAGTAAGCTTTGAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145287.1-282s1c1
Sequence:CCGGCCCTGGCTGTGTATTCTTATTCTCGAGAATAAGAATACACAGCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145287.1-1663s1c1
Sequence:CCGGCCTTACTCAACATCAGAGAATCTCGAGATTCTCTGATGTTGAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145287
VALIDATED
ZNF519 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 519
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145287.2-774s21c1
Sequence:CCGGGCCTTACAACTCTAATGAATGCTCGAGCATTCATTAGAGTTGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145287.2-900s21c1
Sequence:CCGGATCACATCTAAAGGGACATAACTCGAGTTATGTCCCTTTAGATGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145287.2-322s21c1
Sequence:CCGGCAAGGCATACAAGATTCATTCCTCGAGGAATGAATCTTGTATGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145287.2-1760s21c1
Sequence:CCGGTAATTCATACCAGGTAGAAACCTCGAGGTTTCTACCTGGTATGAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145287.1-557s1c1
Sequence:CCGGGCTCCTACAGAACCATGTATTCTCGAGAATACATGGTTCTGTAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145287.1-646s1c1
Sequence:CCGGCCATGACTCAGATATTAGTAACTCGAGTTACTAATATCTGAGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145287.1-815s1c1
Sequence:CCGGCCATTCTCAAAGCTTACTCAACTCGAGTTGAGTAAGCTTTGAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145287.1-282s1c1
Sequence:CCGGCCCTGGCTGTGTATTCTTATTCTCGAGAATAAGAATACACAGCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145287.1-1663s1c1
Sequence:CCGGCCTTACTCAACATCAGAGAATCTCGAGATTCTCTGATGTTGAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks