EMAIL THIS PAGE TO A FRIEND

ZNF521

zinc finger protein 521

Synonyms: EHZF Evi3
Gene ID:
chicken(421083) zinc finger protein 521
dog(490511) zinc finger protein 521
domestic cat(101100846) zinc finger protein 521
Horse(100063937) zinc finger protein 521
domestic guinea pig(100716185) zinc finger protein 521
naked mole-rat(101707730) zinc finger protein 521
cow(538792) zinc finger protein 521
sheep(101120210) zinc finger protein 521
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015461 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126721 MISSION® esiRNA esiRNA human ZNF521 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015461 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160533 predicted 3951
2 SASI_Hs01_00160534 predicted 1801
3 SASI_Hs01_00160535 predicted 3165
4 SASI_Hs01_00160536 predicted 671
5 SASI_Hs01_00160537 predicted 1315
6 SASI_Hs01_00160538 predicted 758
7 SASI_Hs01_00160540 predicted 3012
8 SASI_Hs01_00160541 predicted 1190
9 SASI_Hs01_00160542 predicted 3732
10 SASI_Hs02_00347878 predicted 2886
11 SASI_Hs01_00160539 predicted 801
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015461
VALIDATED
ZNF521 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 521
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015461.1-1920s1c1
Sequence:CCGGGCCCTGAATTATATCCACAATCTCGAGATTGTGGATATAATTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015461.1-3739s1c1
Sequence:CCGGGCATCAAGTGTCAGATGGTTTCTCGAGAAACCATCTGACACTTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_015461.1-1487s1c1
Sequence:CCGGGCCCTCACTCTATAACCTAAACTCGAGTTTAGGTTATAGAGTGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015461.1-738s21c1
Sequence:CCGGACGTCCAACAAGCCATATAAACTCGAGTTTATATGGCTTGTTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015461.1-2210s21c1
Sequence:CCGGTATGATCACTTCAACGTATTACTCGAGTAATACGTTGAAGTGATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015461.1-3955s21c1
Sequence:CCGGACAAGTTGCAGCAGCATATTTCTCGAGAAATATGCTGCTGCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015461.1-4589s21c1
Sequence:CCGGCTGGATAAGGCCCGTATATATCTCGAGATATATACGGGCCTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015461.1-709s21c1
Sequence:GTACCGGATCACTTGAAGATCCACTTAACTCGAGTTAAGTGGATCTTCAAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015461
VALIDATED
ZNF521 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 521
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015461.1-1920s1c1
Sequence:CCGGGCCCTGAATTATATCCACAATCTCGAGATTGTGGATATAATTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015461.1-3739s1c1
Sequence:CCGGGCATCAAGTGTCAGATGGTTTCTCGAGAAACCATCTGACACTTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_015461.1-1487s1c1
Sequence:CCGGGCCCTCACTCTATAACCTAAACTCGAGTTTAGGTTATAGAGTGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015461.1-738s21c1
Sequence:CCGGACGTCCAACAAGCCATATAAACTCGAGTTTATATGGCTTGTTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015461.1-2210s21c1
Sequence:CCGGTATGATCACTTCAACGTATTACTCGAGTAATACGTTGAAGTGATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015461.1-3955s21c1
Sequence:CCGGACAAGTTGCAGCAGCATATTTCTCGAGAAATATGCTGCTGCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015461.1-4589s21c1
Sequence:CCGGCTGGATAAGGCCCGTATATATCTCGAGATATATACGGGCCTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015461.1-709s21c1
Sequence:GTACCGGATCACTTGAAGATCCACTTAACTCGAGTTAAGTGGATCTTCAAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015461
VALIDATED
ZNF521 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 521
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015461.1-1920s1c1
Sequence:CCGGGCCCTGAATTATATCCACAATCTCGAGATTGTGGATATAATTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015461.1-3739s1c1
Sequence:CCGGGCATCAAGTGTCAGATGGTTTCTCGAGAAACCATCTGACACTTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_015461.1-1487s1c1
Sequence:CCGGGCCCTCACTCTATAACCTAAACTCGAGTTTAGGTTATAGAGTGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015461.1-738s21c1
Sequence:CCGGACGTCCAACAAGCCATATAAACTCGAGTTTATATGGCTTGTTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015461.1-2210s21c1
Sequence:CCGGTATGATCACTTCAACGTATTACTCGAGTAATACGTTGAAGTGATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015461.1-3955s21c1
Sequence:CCGGACAAGTTGCAGCAGCATATTTCTCGAGAAATATGCTGCTGCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015461.1-4589s21c1
Sequence:CCGGCTGGATAAGGCCCGTATATATCTCGAGATATATACGGGCCTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015461.1-709s21c1
Sequence:GTACCGGATCACTTGAAGATCCACTTAACTCGAGTTAAGTGGATCTTCAAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks