EMAIL THIS PAGE TO A FRIEND

ZNF524

zinc finger protein 524

UniProtKB ID: Q96C55, Q6NW31, Q96IL7
Gene ID:
cow(789616) zinc finger protein 524
sheep(101118471) zinc finger protein 524
naked mole-rat(101698207) zinc finger protein 524
domestic guinea pig(100732988) zinc finger protein 524
domestic cat(101083634) zinc finger protein 524
dog(100687132) zinc finger protein 524
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153219 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153219 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045928 predicted 357
2 SASI_Hs01_00045929 predicted 471
3 SASI_Hs01_00045930 predicted 197
4 SASI_Hs01_00045931 predicted 352
5 SASI_Hs01_00045932 predicted 502
6 SASI_Hs01_00045933 predicted 196
7 SASI_Hs01_00045934 predicted 703
8 SASI_Hs01_00045935 predicted 784
9 SASI_Hs01_00045936 predicted 685
10 SASI_Hs01_00045937 predicted 957
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153219
VALIDATED
ZNF524 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 524
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153219.2-134s21c1
Sequence:CCGGAGAGAAACCTCTGGCCTTATCCTCGAGGATAAGGCCAGAGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153219.2-909s21c1
Sequence:CCGGAGGTTTAGAGCAGGGAGTTTGCTCGAGCAAACTCCCTGCTCTAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153219.2-511s21c1
Sequence:CCGGAGTGCAAGGTTTGCGGCAAGACTCGAGTCTTGCCGCAAACCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153219.2-347s21c1
Sequence:CCGGTGATCAGGGTGTGCCCTATACCTCGAGGTATAGGGCACACCCTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153219.2-203s21c1
Sequence:CCGGCTCCTCAAATCGGACACTCAACTCGAGTTGAGTGTCCGATTTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153219.2-203s1c1
Sequence:CCGGCTCCTCAAATCGGACACTCAACTCGAGTTGAGTGTCCGATTTGAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153219.2-144s1c1
Sequence:CCGGCTGGCCTTATCTCCTCCTGTTCTCGAGAACAGGAGGAGATAAGGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153219.2-357s1c1
Sequence:CCGGGTGCCCTATACGGTCTCTGAACTCGAGTTCAGAGACCGTATAGGGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_153219.2-774s1c1
Sequence:CCGGGCACCAGATCCAGGGTCTGAACTCGAGTTCAGACCCTGGATCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153219.2-695s1c1
Sequence:CCGGGCTGCGCTTTACAGAGGCCAACTCGAGTTGGCCTCTGTAAAGCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153219
VALIDATED
ZNF524 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 524
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153219.2-134s21c1
Sequence:CCGGAGAGAAACCTCTGGCCTTATCCTCGAGGATAAGGCCAGAGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153219.2-909s21c1
Sequence:CCGGAGGTTTAGAGCAGGGAGTTTGCTCGAGCAAACTCCCTGCTCTAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153219.2-511s21c1
Sequence:CCGGAGTGCAAGGTTTGCGGCAAGACTCGAGTCTTGCCGCAAACCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153219.2-347s21c1
Sequence:CCGGTGATCAGGGTGTGCCCTATACCTCGAGGTATAGGGCACACCCTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153219.2-203s21c1
Sequence:CCGGCTCCTCAAATCGGACACTCAACTCGAGTTGAGTGTCCGATTTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153219.2-203s1c1
Sequence:CCGGCTCCTCAAATCGGACACTCAACTCGAGTTGAGTGTCCGATTTGAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153219.2-144s1c1
Sequence:CCGGCTGGCCTTATCTCCTCCTGTTCTCGAGAACAGGAGGAGATAAGGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153219.2-357s1c1
Sequence:CCGGGTGCCCTATACGGTCTCTGAACTCGAGTTCAGAGACCGTATAGGGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_153219.2-774s1c1
Sequence:CCGGGCACCAGATCCAGGGTCTGAACTCGAGTTCAGACCCTGGATCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153219.2-695s1c1
Sequence:CCGGGCTGCGCTTTACAGAGGCCAACTCGAGTTGGCCTCTGTAAAGCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153219
VALIDATED
ZNF524 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 524
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153219.2-134s21c1
Sequence:CCGGAGAGAAACCTCTGGCCTTATCCTCGAGGATAAGGCCAGAGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153219.2-909s21c1
Sequence:CCGGAGGTTTAGAGCAGGGAGTTTGCTCGAGCAAACTCCCTGCTCTAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153219.2-511s21c1
Sequence:CCGGAGTGCAAGGTTTGCGGCAAGACTCGAGTCTTGCCGCAAACCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153219.2-347s21c1
Sequence:CCGGTGATCAGGGTGTGCCCTATACCTCGAGGTATAGGGCACACCCTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153219.2-203s21c1
Sequence:CCGGCTCCTCAAATCGGACACTCAACTCGAGTTGAGTGTCCGATTTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153219.2-203s1c1
Sequence:CCGGCTCCTCAAATCGGACACTCAACTCGAGTTGAGTGTCCGATTTGAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153219.2-144s1c1
Sequence:CCGGCTGGCCTTATCTCCTCCTGTTCTCGAGAACAGGAGGAGATAAGGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153219.2-357s1c1
Sequence:CCGGGTGCCCTATACGGTCTCTGAACTCGAGTTCAGAGACCGTATAGGGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_153219.2-774s1c1
Sequence:CCGGGCACCAGATCCAGGGTCTGAACTCGAGTTCAGACCCTGGATCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153219.2-695s1c1
Sequence:CCGGGCTGCGCTTTACAGAGGCCAACTCGAGTTGGCCTCTGTAAAGCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks