EMAIL THIS PAGE TO A FRIEND

ZNF526

zinc finger protein 526

UniProtKB ID: Q8TF50, B3KV29, Q69YI2, Q96E24
Gene ID:
dog(484477) zinc finger protein 526
domestic cat(101085165) zinc finger protein 526
domestic guinea pig(100723149) zinc finger protein 526
naked mole-rat(101716164) zinc finger protein 526
Domestic Rabbit(100355744) zinc finger protein 526
cow(514418) zinc finger protein 526
sheep(101103006) zinc finger protein 526
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133444 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017811 MISSION® esiRNA esiRNA targeting human ZNF526 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133444 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027536 predicted 554
2 SASI_Hs01_00027537 predicted 556
3 SASI_Hs01_00027538 predicted 1926
4 SASI_Hs01_00027539 predicted 1132
5 SASI_Hs01_00027540 predicted 1866
6 SASI_Hs01_00027541 predicted 2654
7 SASI_Hs01_00027542 predicted 1867
8 SASI_Hs01_00027543 predicted 239
9 SASI_Hs01_00027545 predicted 381
10 SASI_Hs02_00363117 predicted 247
11 SASI_Hs01_00027544 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133444
VALIDATED
ZNF526 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 526
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133444.1-810s1c1
Sequence:CCGGCCACTTTGACTCCCTAGAGAACTCGAGTTCTCTAGGGAGTCAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133444.1-212s1c1
Sequence:CCGGCAGTGGAGATGTCAACACCTACTCGAGTAGGTGTTGACATCTCCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_133444.1-1857s1c1
Sequence:CCGGCTACAACAAGAGTCCCTACTACTCGAGTAGTAGGGACTCTTGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_133444.1-291s1c1
Sequence:CCGGCCTTGCCTCATCCCTCTTCTTCTCGAGAAGAAGAGGGATGAGGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_133444.1-1590s1c1
Sequence:CCGGCAAGGGCTTCAAGAAGCTGATCTCGAGATCAGCTTCTTGAAGCCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_133444.1-214s21c1
Sequence:CCGGGTGGAGATGTCAACACCTATGCTCGAGCATAGGTGTTGACATCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133444.1-3198s21c1
Sequence:CCGGTTATCCCTGTTGTATAGATTTCTCGAGAAATCTATACAACAGGGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133444.1-2007s21c1
Sequence:CCGGAGAGCCTCAACAGACTATCATCTCGAGATGATAGTCTGTTGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_133444.1-812s21c1
Sequence:CCGGACTTTGACTCCCTAGAGAAAGCTCGAGCTTTCTCTAGGGAGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_133444.1-556s21c1
Sequence:CCGGTCTGCAAACCAGATCCAATACCTCGAGGTATTGGATCTGGTTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133444
VALIDATED
ZNF526 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 526
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133444.1-810s1c1
Sequence:CCGGCCACTTTGACTCCCTAGAGAACTCGAGTTCTCTAGGGAGTCAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133444.1-212s1c1
Sequence:CCGGCAGTGGAGATGTCAACACCTACTCGAGTAGGTGTTGACATCTCCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_133444.1-1857s1c1
Sequence:CCGGCTACAACAAGAGTCCCTACTACTCGAGTAGTAGGGACTCTTGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_133444.1-291s1c1
Sequence:CCGGCCTTGCCTCATCCCTCTTCTTCTCGAGAAGAAGAGGGATGAGGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_133444.1-1590s1c1
Sequence:CCGGCAAGGGCTTCAAGAAGCTGATCTCGAGATCAGCTTCTTGAAGCCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_133444.1-214s21c1
Sequence:CCGGGTGGAGATGTCAACACCTATGCTCGAGCATAGGTGTTGACATCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133444.1-3198s21c1
Sequence:CCGGTTATCCCTGTTGTATAGATTTCTCGAGAAATCTATACAACAGGGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133444.1-2007s21c1
Sequence:CCGGAGAGCCTCAACAGACTATCATCTCGAGATGATAGTCTGTTGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_133444.1-812s21c1
Sequence:CCGGACTTTGACTCCCTAGAGAAAGCTCGAGCTTTCTCTAGGGAGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_133444.1-556s21c1
Sequence:CCGGTCTGCAAACCAGATCCAATACCTCGAGGTATTGGATCTGGTTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133444
VALIDATED
ZNF526 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 526
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133444.1-810s1c1
Sequence:CCGGCCACTTTGACTCCCTAGAGAACTCGAGTTCTCTAGGGAGTCAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133444.1-212s1c1
Sequence:CCGGCAGTGGAGATGTCAACACCTACTCGAGTAGGTGTTGACATCTCCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_133444.1-1857s1c1
Sequence:CCGGCTACAACAAGAGTCCCTACTACTCGAGTAGTAGGGACTCTTGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_133444.1-291s1c1
Sequence:CCGGCCTTGCCTCATCCCTCTTCTTCTCGAGAAGAAGAGGGATGAGGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_133444.1-1590s1c1
Sequence:CCGGCAAGGGCTTCAAGAAGCTGATCTCGAGATCAGCTTCTTGAAGCCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_133444.1-214s21c1
Sequence:CCGGGTGGAGATGTCAACACCTATGCTCGAGCATAGGTGTTGACATCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133444.1-3198s21c1
Sequence:CCGGTTATCCCTGTTGTATAGATTTCTCGAGAAATCTATACAACAGGGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133444.1-2007s21c1
Sequence:CCGGAGAGCCTCAACAGACTATCATCTCGAGATGATAGTCTGTTGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_133444.1-812s21c1
Sequence:CCGGACTTTGACTCCCTAGAGAAAGCTCGAGCTTTCTCTAGGGAGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_133444.1-556s21c1
Sequence:CCGGTCTGCAAACCAGATCCAATACCTCGAGGTATTGGATCTGGTTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks