EMAIL THIS PAGE TO A FRIEND

ZNF527

zinc finger protein 527

UniProtKB ID: Q8NB42, B4DVL5
Gene ID:
cow(538845) zinc finger protein 527
sheep(101101913) zinc finger protein 527
Domestic Rabbit(100352067) zinc finger protein 527
naked mole-rat(101724372) zinc finger protein 527
domestic guinea pig(100729162) zinc finger protein 527
dog(100686669) zinc finger protein 527
domestic cat(101081774) zinc finger protein 527
Horse(100062669) zinc finger protein 527
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032453 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062651 MISSION® esiRNA esiRNA human ZNF527 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032453 Rosetta Predictions human pricing
XM_030378 Rosetta Predictions human pricing
XM_933040 Rosetta Predictions human pricing
XM_933045 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359880 predicted 1523
2 SASI_Hs02_00359881 predicted 661
3 SASI_Hs02_00359882 predicted 527
4 SASI_Hs02_00359883 predicted 1619
5 SASI_Hs02_00359884 predicted 1171
6 SASI_Hs02_00359885 predicted 1800
7 SASI_Hs02_00359886 predicted 443
8 SASI_Hs02_00359887 predicted 1216
9 SASI_Hs02_00359888 predicted 840
10 SASI_Hs02_00359889 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_030378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259686 predicted 1421
2 SASI_Hs01_00259687 predicted 554
3 SASI_Hs01_00259688 predicted 417
4 SASI_Hs01_00259689 predicted 491
5 SASI_Hs01_00259690 predicted 1515
6 SASI_Hs01_00259691 predicted 1060
7 SASI_Hs01_00259692 predicted 1688
8 SASI_Hs01_00259693 predicted 338
9 SASI_Hs01_00259694 predicted 1101
10 SASI_Hs01_00259695 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274151 predicted 1492
2 SASI_Hs01_00274152 predicted 630
3 SASI_Hs01_00274153 predicted 495
4 SASI_Hs01_00274154 predicted 559
5 SASI_Hs01_00274155 predicted 1598
6 SASI_Hs01_00274156 predicted 1139
7 SASI_Hs01_00274157 predicted 1761
8 SASI_Hs01_00274158 predicted 410
9 SASI_Hs01_00274159 predicted 1182
10 SASI_Hs01_00274160 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265436 predicted 153
2 SASI_Hs01_00265437 predicted 877
3 SASI_Hs01_00265438 predicted 873
4 SASI_Hs01_00265439 predicted 941
5 SASI_Hs01_00265440 predicted 196
6 SASI_Hs01_00265441 predicted 198
7 SASI_Hs01_00265442 predicted 943
8 SASI_Hs01_00265443 predicted 205
9 SASI_Hs01_00265444 predicted 970
10 SASI_Hs01_00265445 predicted 320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032453
ZNF527 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 527
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032453.1-758s21c1
Sequence:CCGGAGGAATCTTTGATAGGTAATGCTCGAGCATTACCTATCAAAGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032453.1-843s21c1
Sequence:CCGGACCTTATGAAAGTCATGATTTCTCGAGAAATCATGACTTTCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032453.1-2047s21c1
Sequence:CCGGGTTCATGAGTATCCGTTATTTCTCGAGAAATAACGGATACTCATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032453.1-796s21c1
Sequence:CCGGCAGAGTACGTACCTTAGTAAACTCGAGTTTACTAAGGTACGTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032453.1-499s21c1
Sequence:CCGGTGGAAATATAAGGGTGAATTTCTCGAGAAATTCACCCTTATATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032453
ZNF527 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 527
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032453.1-758s21c1
Sequence:CCGGAGGAATCTTTGATAGGTAATGCTCGAGCATTACCTATCAAAGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032453.1-843s21c1
Sequence:CCGGACCTTATGAAAGTCATGATTTCTCGAGAAATCATGACTTTCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032453.1-2047s21c1
Sequence:CCGGGTTCATGAGTATCCGTTATTTCTCGAGAAATAACGGATACTCATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032453.1-796s21c1
Sequence:CCGGCAGAGTACGTACCTTAGTAAACTCGAGTTTACTAAGGTACGTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032453.1-499s21c1
Sequence:CCGGTGGAAATATAAGGGTGAATTTCTCGAGAAATTCACCCTTATATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032453
ZNF527 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 527
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032453.1-758s21c1
Sequence:CCGGAGGAATCTTTGATAGGTAATGCTCGAGCATTACCTATCAAAGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032453.1-843s21c1
Sequence:CCGGACCTTATGAAAGTCATGATTTCTCGAGAAATCATGACTTTCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032453.1-2047s21c1
Sequence:CCGGGTTCATGAGTATCCGTTATTTCTCGAGAAATAACGGATACTCATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032453.1-796s21c1
Sequence:CCGGCAGAGTACGTACCTTAGTAAACTCGAGTTTACTAAGGTACGTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032453.1-499s21c1
Sequence:CCGGTGGAAATATAAGGGTGAATTTCTCGAGAAATTCACCCTTATATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks