EMAIL THIS PAGE TO A FRIEND

ZNF528

zinc finger protein 528

Species: Human ZNF528(84436)
UniProtKB ID: Q3MIS6, B3KPN4, Q86T88, Q96JK0
Gene ID:
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032423 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032423 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021250 predicted 845
2 SASI_Hs01_00021251 predicted 1092
3 SASI_Hs01_00021252 predicted 1933
4 SASI_Hs01_00021253 predicted 2341
5 SASI_Hs01_00021255 predicted 1261
6 SASI_Hs02_00359826 predicted 1585
7 SASI_Hs02_00359827 predicted 2022
8 SASI_Hs01_00021257 predicted 2007
9 SASI_Hs01_00021258 predicted 1027
10 SASI_Hs01_00021259 predicted 1082
11 SASI_Hs01_00021254 predicted 1056
12 SASI_Hs01_00021256 predicted 1186
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032423
ZNF528 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 528
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032423.2-2344s21c1
Sequence:CCGGCATCATGAGTTCTAGCATTAACTCGAGTTAATGCTAGAACTCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032423.2-2569s21c1
Sequence:CCGGCTCTGGTTCTCTGATACTAATCTCGAGATTAGTATCAGAGAACCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032423.2-1038s21c1
Sequence:CCGGAGTAATCCATAACGCAGATAACTCGAGTTATCTGCGTTATGGATTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032423.2-2530s21c1
Sequence:CCGGTATAGAACACGATAGGATTTACTCGAGTAAATCCTATCGTGTTCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032423.2-2065s21c1
Sequence:CCGGAGGCCTTACAGATGTAGTAAACTCGAGTTTACTACATCTGTAAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032423.1-934s1c1
Sequence:CCGGGCTCCATTACTTCCACAAGAACTCGAGTTCTTGTGGAAGTAATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032423.1-2198s1c1
Sequence:CCGGCCCTCACCAATCACCATAGAACTCGAGTTCTATGGTGATTGGTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032423.1-1170s1c1
Sequence:CCGGGCTCTTCAGTAGCAATTCAAACTCGAGTTTGAATTGCTACTGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032423.1-1354s1c1
Sequence:CCGGGCACACCTTGTACGACATCAACTCGAGTTGATGTCGTACAAGGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032423.1-2090s1c1
Sequence:CCGGGCAAAGCATTTCGAGGGTGTTCTCGAGAACACCCTCGAAATGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032423
ZNF528 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 528
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032423.2-2344s21c1
Sequence:CCGGCATCATGAGTTCTAGCATTAACTCGAGTTAATGCTAGAACTCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032423.2-2569s21c1
Sequence:CCGGCTCTGGTTCTCTGATACTAATCTCGAGATTAGTATCAGAGAACCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032423.2-1038s21c1
Sequence:CCGGAGTAATCCATAACGCAGATAACTCGAGTTATCTGCGTTATGGATTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032423.2-2530s21c1
Sequence:CCGGTATAGAACACGATAGGATTTACTCGAGTAAATCCTATCGTGTTCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032423.2-2065s21c1
Sequence:CCGGAGGCCTTACAGATGTAGTAAACTCGAGTTTACTACATCTGTAAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032423.1-934s1c1
Sequence:CCGGGCTCCATTACTTCCACAAGAACTCGAGTTCTTGTGGAAGTAATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032423.1-2198s1c1
Sequence:CCGGCCCTCACCAATCACCATAGAACTCGAGTTCTATGGTGATTGGTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032423.1-1170s1c1
Sequence:CCGGGCTCTTCAGTAGCAATTCAAACTCGAGTTTGAATTGCTACTGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032423.1-1354s1c1
Sequence:CCGGGCACACCTTGTACGACATCAACTCGAGTTGATGTCGTACAAGGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032423.1-2090s1c1
Sequence:CCGGGCAAAGCATTTCGAGGGTGTTCTCGAGAACACCCTCGAAATGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032423
ZNF528 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 528
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032423.2-2344s21c1
Sequence:CCGGCATCATGAGTTCTAGCATTAACTCGAGTTAATGCTAGAACTCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032423.2-2569s21c1
Sequence:CCGGCTCTGGTTCTCTGATACTAATCTCGAGATTAGTATCAGAGAACCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032423.2-1038s21c1
Sequence:CCGGAGTAATCCATAACGCAGATAACTCGAGTTATCTGCGTTATGGATTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032423.2-2530s21c1
Sequence:CCGGTATAGAACACGATAGGATTTACTCGAGTAAATCCTATCGTGTTCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032423.2-2065s21c1
Sequence:CCGGAGGCCTTACAGATGTAGTAAACTCGAGTTTACTACATCTGTAAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032423.1-934s1c1
Sequence:CCGGGCTCCATTACTTCCACAAGAACTCGAGTTCTTGTGGAAGTAATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032423.1-2198s1c1
Sequence:CCGGCCCTCACCAATCACCATAGAACTCGAGTTCTATGGTGATTGGTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032423.1-1170s1c1
Sequence:CCGGGCTCTTCAGTAGCAATTCAAACTCGAGTTTGAATTGCTACTGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032423.1-1354s1c1
Sequence:CCGGGCACACCTTGTACGACATCAACTCGAGTTGATGTCGTACAAGGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032423.1-2090s1c1
Sequence:CCGGGCAAAGCATTTCGAGGGTGTTCTCGAGAACACCCTCGAAATGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks