EMAIL THIS PAGE TO A FRIEND

ZNF529

zinc finger protein 529

UniProtKB ID: Q6P280, K7EKE1, Q9H731, Q9HCF7
Gene ID:
dog(100687560) zinc finger protein 529
domestic cat(101095535) zinc finger protein 529
domestic guinea pig(101787078) zinc finger protein 529
naked mole-rat(101727531) zinc finger protein 529
cow(510501) zinc finger protein 529
sheep(101106618) zinc finger protein 529
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020951 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020951 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020951 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045721 MISSION® esiRNA esiRNA human ZNF529 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020951 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236501 predicted 876
2 SASI_Hs01_00236502 predicted 1034
3 SASI_Hs01_00236503 predicted 748
4 SASI_Hs01_00236504 predicted 831
5 SASI_Hs01_00236506 predicted 1062
6 SASI_Hs02_00354376 predicted 706
7 SASI_Hs01_00236507 predicted 1498
8 SASI_Hs01_00236508 predicted 671
9 SASI_Hs01_00236509 predicted 732
10 SASI_Hs02_00354377 predicted 510
11 SASI_Hs01_00236505 predicted 1044
12 SASI_Hs01_00236510 predicted 924
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020951
VALIDATED
ZNF529 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 529
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_020951.1-1872s1c1
Sequence:CCGGGCGCATTCATACTGATGATAACTCGAGTTATCATCAGTATGAATGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020951.1-935s1c1
Sequence:CCGGCCAGTATGTTACAACTGAATACTCGAGTATTCAGTTGTAACATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020951.1-1938s1c1
Sequence:CCGGGCATCTTACTTGCCAACCGAACTCGAGTTCGGTTGGCAAGTAAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_020951.1-767s1c1
Sequence:CCGGCTCTTACTTTACCTCGGAGAACTCGAGTTCTCCGAGGTAAAGTAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020951.1-1601s1c1
Sequence:CCGGGTGAACTTACTCGACATGAAACTCGAGTTTCATGTCGAGTAAGTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020951.3-500s21c1
Sequence:CCGGGGTTCTCAGTGGGAGGTAATGCTCGAGCATTACCTCCCACTGAGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_020951.3-749s21c1
Sequence:CCGGGACTTAGAGTTTGATGAATATCTCGAGATATTCATCAAACTCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020951.3-537s21c1
Sequence:CCGGGTGGCCTTGAAGGTTCCATTTCTCGAGAAATGGAACCTTCAAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020951.3-2044s21c1
Sequence:CCGGCTTAGTCATAGCTGATATATACTCGAGTATATATCAGCTATGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020951.3-599s21c1
Sequence:CCGGGGACCTGAAGTGGGATATTTCCTCGAGGAAATATCCCACTTCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020951
VALIDATED
ZNF529 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 529
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_020951.1-1872s1c1
Sequence:CCGGGCGCATTCATACTGATGATAACTCGAGTTATCATCAGTATGAATGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020951.1-935s1c1
Sequence:CCGGCCAGTATGTTACAACTGAATACTCGAGTATTCAGTTGTAACATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020951.1-1938s1c1
Sequence:CCGGGCATCTTACTTGCCAACCGAACTCGAGTTCGGTTGGCAAGTAAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_020951.1-767s1c1
Sequence:CCGGCTCTTACTTTACCTCGGAGAACTCGAGTTCTCCGAGGTAAAGTAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020951.1-1601s1c1
Sequence:CCGGGTGAACTTACTCGACATGAAACTCGAGTTTCATGTCGAGTAAGTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020951.3-500s21c1
Sequence:CCGGGGTTCTCAGTGGGAGGTAATGCTCGAGCATTACCTCCCACTGAGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_020951.3-749s21c1
Sequence:CCGGGACTTAGAGTTTGATGAATATCTCGAGATATTCATCAAACTCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020951.3-537s21c1
Sequence:CCGGGTGGCCTTGAAGGTTCCATTTCTCGAGAAATGGAACCTTCAAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020951.3-2044s21c1
Sequence:CCGGCTTAGTCATAGCTGATATATACTCGAGTATATATCAGCTATGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020951.3-599s21c1
Sequence:CCGGGGACCTGAAGTGGGATATTTCCTCGAGGAAATATCCCACTTCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020951
VALIDATED
ZNF529 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 529
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_020951.1-1872s1c1
Sequence:CCGGGCGCATTCATACTGATGATAACTCGAGTTATCATCAGTATGAATGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020951.1-935s1c1
Sequence:CCGGCCAGTATGTTACAACTGAATACTCGAGTATTCAGTTGTAACATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020951.1-1938s1c1
Sequence:CCGGGCATCTTACTTGCCAACCGAACTCGAGTTCGGTTGGCAAGTAAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_020951.1-767s1c1
Sequence:CCGGCTCTTACTTTACCTCGGAGAACTCGAGTTCTCCGAGGTAAAGTAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020951.1-1601s1c1
Sequence:CCGGGTGAACTTACTCGACATGAAACTCGAGTTTCATGTCGAGTAAGTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020951.3-500s21c1
Sequence:CCGGGGTTCTCAGTGGGAGGTAATGCTCGAGCATTACCTCCCACTGAGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_020951.3-749s21c1
Sequence:CCGGGACTTAGAGTTTGATGAATATCTCGAGATATTCATCAAACTCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020951.3-537s21c1
Sequence:CCGGGTGGCCTTGAAGGTTCCATTTCTCGAGAAATGGAACCTTCAAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020951.3-2044s21c1
Sequence:CCGGCTTAGTCATAGCTGATATATACTCGAGTATATATCAGCTATGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020951.3-599s21c1
Sequence:CCGGGGACCTGAAGTGGGATATTTCCTCGAGGAAATATCCCACTTCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks