EMAIL THIS PAGE TO A FRIEND

ZNF530

zinc finger protein 530

Species: Human ZNF530(348327)
UniProtKB ID: Q6P9A1, O43340, Q9P220
Gene ID:
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020880 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020880 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020880 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106211 MISSION® esiRNA esiRNA human ZNF530 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020880 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236421 predicted 1373
2 SASI_Hs01_00236422 predicted 859
3 SASI_Hs01_00236423 predicted 838
4 SASI_Hs02_00354180 predicted 1377
5 SASI_Hs01_00236424 predicted 1060
6 SASI_Hs01_00236425 predicted 1370
7 SASI_Hs02_00354181 predicted 1448
8 SASI_Hs01_00236426 predicted 361
9 SASI_Hs01_00236428 predicted 1748
10 SASI_Hs01_00236430 predicted 350
11 SASI_Hs01_00236427 predicted 1042
12 SASI_Hs01_00236429 predicted 1120
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020880
ZNF530 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 530
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020880.2-1122s1c1
Sequence:CCGGGCAAATCCTTTCGCCAGGTATCTCGAGATACCTGGCGAAAGGATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020880.2-891s1c1
Sequence:CCGGCTGTATTCATTCAACACCAAACTCGAGTTTGGTGTTGAATGAATACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020880.2-1983s1c1
Sequence:CCGGCTGGCCTCTTAAGACACAGAACTCGAGTTCTGTGTCTTAAGAGGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020880.2-673s1c1
Sequence:CCGGCCAGGCCTCATTTATGATGAACTCGAGTTCATCATAAATGAGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020880.2-1395s1c1
Sequence:CCGGTCTACCTTATTCACCACCAAACTCGAGTTTGGTGGTGAATAAGGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020880
ZNF530 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 530
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020880.2-1122s1c1
Sequence:CCGGGCAAATCCTTTCGCCAGGTATCTCGAGATACCTGGCGAAAGGATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020880.2-891s1c1
Sequence:CCGGCTGTATTCATTCAACACCAAACTCGAGTTTGGTGTTGAATGAATACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020880.2-1983s1c1
Sequence:CCGGCTGGCCTCTTAAGACACAGAACTCGAGTTCTGTGTCTTAAGAGGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020880.2-673s1c1
Sequence:CCGGCCAGGCCTCATTTATGATGAACTCGAGTTCATCATAAATGAGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020880.2-1395s1c1
Sequence:CCGGTCTACCTTATTCACCACCAAACTCGAGTTTGGTGGTGAATAAGGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020880
ZNF530 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 530
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020880.2-1122s1c1
Sequence:CCGGGCAAATCCTTTCGCCAGGTATCTCGAGATACCTGGCGAAAGGATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020880.2-891s1c1
Sequence:CCGGCTGTATTCATTCAACACCAAACTCGAGTTTGGTGTTGAATGAATACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020880.2-1983s1c1
Sequence:CCGGCTGGCCTCTTAAGACACAGAACTCGAGTTCTGTGTCTTAAGAGGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020880.2-673s1c1
Sequence:CCGGCCAGGCCTCATTTATGATGAACTCGAGTTCATCATAAATGAGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020880.2-1395s1c1
Sequence:CCGGTCTACCTTATTCACCACCAAACTCGAGTTTGGTGGTGAATAAGGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks