EMAIL THIS PAGE TO A FRIEND

ZNF534

zinc finger protein 534

Synonyms: KRBO3
Species: Human ZNF534(147658)
UniProtKB ID: Q76KX8, Q76KX9
Gene ID:
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102901 Anti-ZNF534 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001718217 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001718217 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001718217 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182512 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718217 Rosetta Predictions human pricing
XM_001718845 Rosetta Predictions human pricing
XM_496320 Rosetta Predictions human pricing
XM_935374 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00422260 predicted 1616
2 SASI_Hs02_00422261 predicted 1628
3 SASI_Hs02_00422262 predicted 773
4 SASI_Hs02_00422263 predicted 1021
5 SASI_Hs02_00422264 predicted 438
6 SASI_Hs02_00422265 predicted 473
7 SASI_Hs02_00422266 predicted 479
8 SASI_Hs02_00422267 predicted 1450
9 SASI_Hs02_00422268 predicted 493
10 SASI_Hs02_00422269 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00426669 predicted 1619
2 SASI_Hs02_00426670 predicted 1628
3 SASI_Hs02_00426671 predicted 769
4 SASI_Hs02_00426672 predicted 1019
5 SASI_Hs02_00426673 predicted 445
6 SASI_Hs02_00426674 predicted 469
7 SASI_Hs02_00426675 predicted 476
8 SASI_Hs02_00426676 predicted 1454
9 SASI_Hs02_00426677 predicted 494
10 SASI_Hs02_00426678 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480005 predicted 1614
2 SASI_Hs02_00480006 predicted 1624
3 SASI_Hs02_00480007 predicted 774
4 SASI_Hs02_00480008 predicted 1024
5 SASI_Hs01_00284638 predicted 442
6 SASI_Hs01_00284640 predicted 481
7 SASI_Hs02_00480009 predicted 1450
8 SASI_Hs02_00480010 predicted 1453
9 SASI_Hs02_00480011 predicted 1009
10 SASI_Hs02_00480012 predicted 1790
11 SASI_Hs01_00284637 predicted 449
12 SASI_Hs01_00284639 predicted 458
13 SASI_Hs01_00284641 predicted 493
14 SASI_Hs01_00284642 predicted 463
15 SASI_Hs01_00284643 predicted 480
16 SASI_Hs01_00284644 predicted 447
17 SASI_Hs01_00284645 predicted 481
18 SASI_Hs01_00284646 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257332 predicted 414
2 SASI_Hs01_00257333 predicted 404
3 SASI_Hs01_00257334 predicted 419
4 SASI_Hs01_00257335 predicted 447
5 SASI_Hs01_00257336 predicted 449
6 SASI_Hs01_00257337 predicted 420
7 SASI_Hs01_00257338 predicted 441
8 SASI_Hs01_00257339 predicted 408
9 SASI_Hs01_00257340 predicted 442
10 SASI_Hs01_00257341 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001718217
ZNF534 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 534
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000219829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001718217.1-753s1c1
Sequence:CCGGGCGAGATCTTTAGTAGCAATTCTCGAGAATTGCTACTAAAGATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001718217.1-1619s1c1
Sequence:CCGGCTTGCACAACATAGGGATATTCTCGAGAATATCCCTATGTTGTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001718217.1-1787s1c1
Sequence:CCGGCTTGCGCGACATAGGAATATTCTCGAGAATATTCCTATGTCGCGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001718217.1-1276s1c1
Sequence:CCGGTTCACGCCTTGCACGACATAGCTCGAGCTATGTCGTGCAAGGCGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001718217
ZNF534 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 534
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000219829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001718217.1-753s1c1
Sequence:CCGGGCGAGATCTTTAGTAGCAATTCTCGAGAATTGCTACTAAAGATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001718217.1-1619s1c1
Sequence:CCGGCTTGCACAACATAGGGATATTCTCGAGAATATCCCTATGTTGTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001718217.1-1787s1c1
Sequence:CCGGCTTGCGCGACATAGGAATATTCTCGAGAATATTCCTATGTCGCGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001718217.1-1276s1c1
Sequence:CCGGTTCACGCCTTGCACGACATAGCTCGAGCTATGTCGTGCAAGGCGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001718217
ZNF534 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 534
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000219829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001718217.1-753s1c1
Sequence:CCGGGCGAGATCTTTAGTAGCAATTCTCGAGAATTGCTACTAAAGATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001718217.1-1619s1c1
Sequence:CCGGCTTGCACAACATAGGGATATTCTCGAGAATATCCCTATGTTGTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001718217.1-1787s1c1
Sequence:CCGGCTTGCGCGACATAGGAATATTCTCGAGAATATTCCTATGTCGCGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001718217.1-1276s1c1
Sequence:CCGGTTCACGCCTTGCACGACATAGCTCGAGCTATGTCGTGCAAGGCGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182512
ZNF534 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 534
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-525s1c1
Sequence:CCGGCTGCTACCATTTCCTTCCGTTCTCGAGAACGGAAGGAAATGGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-380s1c1
Sequence:CCGGCAAAGGTGTGAACGCAGATTTCTCGAGAAATCTGCGTTCACACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-233s1c1
Sequence:CCGGGATGTTAGAGAACTACAGGAACTCGAGTTCCTGTAGTTCTCTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-291s1c1
Sequence:CCGGGTTAACTCCATGTTGGAGCAACTCGAGTTGCTCCAACATGGAGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-224s1c1
Sequence:CCGGCAGGGACGTGATGTTAGAGAACTCGAGTTCTCTAACATCACGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-284s1c1
Sequence:CCGGCCTGAGTGTTAACTCCATGTTCTCGAGAACATGGAGTTAACACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-209s1c1
Sequence:CCGGGCAGAAAGCTTTATACAGGGACTCGAGTCCCTGTATAAAGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-268s1c1
Sequence:CCGGGAATCTGTCTTCCTGACCTGACTCGAGTCAGGTCAGGAAGACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182512
ZNF534 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 534
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-525s1c1
Sequence:CCGGCTGCTACCATTTCCTTCCGTTCTCGAGAACGGAAGGAAATGGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-380s1c1
Sequence:CCGGCAAAGGTGTGAACGCAGATTTCTCGAGAAATCTGCGTTCACACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-233s1c1
Sequence:CCGGGATGTTAGAGAACTACAGGAACTCGAGTTCCTGTAGTTCTCTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-291s1c1
Sequence:CCGGGTTAACTCCATGTTGGAGCAACTCGAGTTGCTCCAACATGGAGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-224s1c1
Sequence:CCGGCAGGGACGTGATGTTAGAGAACTCGAGTTCTCTAACATCACGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-284s1c1
Sequence:CCGGCCTGAGTGTTAACTCCATGTTCTCGAGAACATGGAGTTAACACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-209s1c1
Sequence:CCGGGCAGAAAGCTTTATACAGGGACTCGAGTCCCTGTATAAAGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-268s1c1
Sequence:CCGGGAATCTGTCTTCCTGACCTGACTCGAGTCAGGTCAGGAAGACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182512
ZNF534 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 534
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-525s1c1
Sequence:CCGGCTGCTACCATTTCCTTCCGTTCTCGAGAACGGAAGGAAATGGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-380s1c1
Sequence:CCGGCAAAGGTGTGAACGCAGATTTCTCGAGAAATCTGCGTTCACACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-233s1c1
Sequence:CCGGGATGTTAGAGAACTACAGGAACTCGAGTTCCTGTAGTTCTCTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-291s1c1
Sequence:CCGGGTTAACTCCATGTTGGAGCAACTCGAGTTGCTCCAACATGGAGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-224s1c1
Sequence:CCGGCAGGGACGTGATGTTAGAGAACTCGAGTTCTCTAACATCACGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-284s1c1
Sequence:CCGGCCTGAGTGTTAACTCCATGTTCTCGAGAACATGGAGTTAACACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-209s1c1
Sequence:CCGGGCAGAAAGCTTTATACAGGGACTCGAGTCCCTGTATAAAGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182512.1-268s1c1
Sequence:CCGGGAATCTGTCTTCCTGACCTGACTCGAGTCAGGTCAGGAAGACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks