EMAIL THIS PAGE TO A FRIEND

ZNF536

zinc finger protein 536

UniProtKB ID: O15090, A2RU18
Gene ID:
Zebrafish(565481) zinc finger protein 536
chicken(415761) zinc finger protein 536
domestic cat(101093314) zinc finger protein 536
Horse(100054074) zinc finger protein 536
dog(484609) zinc finger protein 536
domestic guinea pig(100727017) zinc finger protein 536
naked mole-rat(101712667) zinc finger protein 536
Domestic Rabbit(100352806) zinc finger protein 536
cow(520269) zinc finger protein 536
sheep(101115728) zinc finger protein 536
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500453 Anti-ZNF536 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2900864 Anti-ZNF536 antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB1307153 ANTI-ZNF536(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014717 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012891 MISSION® esiRNA esiRNA targeting human ZNF536 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014717 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137142 predicted 1732
2 SASI_Hs02_00346143 predicted 227
3 SASI_Hs02_00346144 predicted 4121
4 SASI_Hs01_00137144 predicted 3328
5 SASI_Hs01_00137145 predicted 3989
6 SASI_Hs01_00137147 predicted 3912
7 SASI_Hs01_00137148 predicted 2814
8 SASI_Hs01_00137149 predicted 3945
9 SASI_Hs01_00137150 predicted 2488
10 SASI_Hs02_00346145 predicted 3591
11 SASI_Hs01_00137141 predicted 2612
12 SASI_Hs01_00137143 predicted 1320
13 SASI_Hs01_00137146 predicted 1314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014717
VALIDATED
ZNF536 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 536
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014717.1-3693s1c1
Sequence:CCGGCGAACCGGAAATGATGACCAACTCGAGTTGGTCATCATTTCCGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014717.1-3682s1c1
Sequence:CCGGGATGTTGAAACCGAACCGGAACTCGAGTTCCGGTTCGGTTTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014717.1-1779s1c1
Sequence:CCGGCCACGAAGACACTTTGGCAAACTCGAGTTTGCCAAAGTGTCTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014717.1-1876s1c1
Sequence:CCGGGCTGATTTGGTTCACAGCACTCTCGAGAGTGCTGTGAACCAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014717.1-1879s1c1
Sequence:CCGGGATTTGGTTCACAGCACTAAACTCGAGTTTAGTGCTGTGAACCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014717.1-3221s1c1
Sequence:CCGGCGAAACGCAAAGATAACACCACTCGAGTGGTGTTATCTTTGCGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014717.1-2502s21c1
Sequence:CCGGCACGCAGTCAGCATCCTTAAACTCGAGTTTAAGGATGCTGACTGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014717.1-3221s21c1
Sequence:CCGGCGAAACGCAAAGATAACACCACTCGAGTGGTGTTATCTTTGCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014717.1-1779s21c1
Sequence:CCGGCCACGAAGACACTTTGGCAAACTCGAGTTTGCCAAAGTGTCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014717.1-3682s21c1
Sequence:CCGGGATGTTGAAACCGAACCGGAACTCGAGTTCCGGTTCGGTTTCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014717.1-2419s21c1
Sequence:CCGGCGGACATCCCATCACCTTAAGCTCGAGCTTAAGGTGATGGGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014717.1-4085s21c1
Sequence:CCGGTTCGTGGTCCTCGGTGGTTATCTCGAGATAACCACCGAGGACCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014717.1-4108s21c1
Sequence:CCGGGCAGCTTGTTAATCGTGTAAACTCGAGTTTACACGATTAACAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014717.1-1879s21c1
Sequence:CCGGGATTTGGTTCACAGCACTAAACTCGAGTTTAGTGCTGTGAACCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014717
VALIDATED
ZNF536 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 536
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014717.1-3693s1c1
Sequence:CCGGCGAACCGGAAATGATGACCAACTCGAGTTGGTCATCATTTCCGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014717.1-3682s1c1
Sequence:CCGGGATGTTGAAACCGAACCGGAACTCGAGTTCCGGTTCGGTTTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014717.1-1779s1c1
Sequence:CCGGCCACGAAGACACTTTGGCAAACTCGAGTTTGCCAAAGTGTCTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014717.1-1876s1c1
Sequence:CCGGGCTGATTTGGTTCACAGCACTCTCGAGAGTGCTGTGAACCAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014717.1-1879s1c1
Sequence:CCGGGATTTGGTTCACAGCACTAAACTCGAGTTTAGTGCTGTGAACCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014717.1-3221s1c1
Sequence:CCGGCGAAACGCAAAGATAACACCACTCGAGTGGTGTTATCTTTGCGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014717.1-2502s21c1
Sequence:CCGGCACGCAGTCAGCATCCTTAAACTCGAGTTTAAGGATGCTGACTGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014717.1-3221s21c1
Sequence:CCGGCGAAACGCAAAGATAACACCACTCGAGTGGTGTTATCTTTGCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014717.1-1779s21c1
Sequence:CCGGCCACGAAGACACTTTGGCAAACTCGAGTTTGCCAAAGTGTCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014717.1-3682s21c1
Sequence:CCGGGATGTTGAAACCGAACCGGAACTCGAGTTCCGGTTCGGTTTCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014717.1-2419s21c1
Sequence:CCGGCGGACATCCCATCACCTTAAGCTCGAGCTTAAGGTGATGGGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014717.1-4085s21c1
Sequence:CCGGTTCGTGGTCCTCGGTGGTTATCTCGAGATAACCACCGAGGACCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014717.1-4108s21c1
Sequence:CCGGGCAGCTTGTTAATCGTGTAAACTCGAGTTTACACGATTAACAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014717.1-1879s21c1
Sequence:CCGGGATTTGGTTCACAGCACTAAACTCGAGTTTAGTGCTGTGAACCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014717
VALIDATED
ZNF536 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 536
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014717.1-3693s1c1
Sequence:CCGGCGAACCGGAAATGATGACCAACTCGAGTTGGTCATCATTTCCGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014717.1-3682s1c1
Sequence:CCGGGATGTTGAAACCGAACCGGAACTCGAGTTCCGGTTCGGTTTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014717.1-1779s1c1
Sequence:CCGGCCACGAAGACACTTTGGCAAACTCGAGTTTGCCAAAGTGTCTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014717.1-1876s1c1
Sequence:CCGGGCTGATTTGGTTCACAGCACTCTCGAGAGTGCTGTGAACCAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014717.1-1879s1c1
Sequence:CCGGGATTTGGTTCACAGCACTAAACTCGAGTTTAGTGCTGTGAACCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014717.1-3221s1c1
Sequence:CCGGCGAAACGCAAAGATAACACCACTCGAGTGGTGTTATCTTTGCGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014717.1-2502s21c1
Sequence:CCGGCACGCAGTCAGCATCCTTAAACTCGAGTTTAAGGATGCTGACTGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014717.1-3221s21c1
Sequence:CCGGCGAAACGCAAAGATAACACCACTCGAGTGGTGTTATCTTTGCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014717.1-1779s21c1
Sequence:CCGGCCACGAAGACACTTTGGCAAACTCGAGTTTGCCAAAGTGTCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014717.1-3682s21c1
Sequence:CCGGGATGTTGAAACCGAACCGGAACTCGAGTTCCGGTTCGGTTTCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014717.1-2419s21c1
Sequence:CCGGCGGACATCCCATCACCTTAAGCTCGAGCTTAAGGTGATGGGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014717.1-4085s21c1
Sequence:CCGGTTCGTGGTCCTCGGTGGTTATCTCGAGATAACCACCGAGGACCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014717.1-4108s21c1
Sequence:CCGGGCAGCTTGTTAATCGTGTAAACTCGAGTTTACACGATTAACAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014717.1-1879s21c1
Sequence:CCGGGATTTGGTTCACAGCACTAAACTCGAGTTTAGTGCTGTGAACCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks