EMAIL THIS PAGE TO A FRIEND

ZNF540

zinc finger protein 540

Synonyms: Nbla10512
Species: Human ZNF540(163255)
Gene ID:
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152606 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152606 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152606 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152606 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042403 predicted 930
2 SASI_Hs02_00366454 predicted 2330
3 SASI_Hs01_00042404 predicted 1347
4 SASI_Hs01_00042406 predicted 720
5 SASI_Hs01_00042407 predicted 607
6 SASI_Hs01_00042408 predicted 1796
7 SASI_Hs02_00366455 predicted 1770
8 SASI_Hs01_00042410 predicted 1608
9 SASI_Hs01_00042411 predicted 734
10 SASI_Hs02_00366456 predicted 2100
11 SASI_Hs01_00042402 predicted 1270
12 SASI_Hs01_00042405 predicted 716
13 SASI_Hs01_00042409 predicted 626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152606
ZNF540 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 540
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152606.2-1518s21c1
Sequence:CCGGGGACAGCTTAATCGGCATAAACTCGAGTTTATGCCGATTAAGCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152606.2-1928s21c1
Sequence:CCGGTATTCGTAGAGGGAATCTTAACTCGAGTTAAGATTCCCTCTACGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152606.2-664s21c1
Sequence:CCGGTTCGTCTGAAAGGATCCATTTCTCGAGAAATGGATCCTTTCAGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152606.2-2329s21c1
Sequence:CCGGTTCCATGTCATGCTCTATTTACTCGAGTAAATAGAGCATGACATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152606.2-628s21c1
Sequence:CCGGTATCCAAAGAGAGTATAATAGCTCGAGCTATTATACTCTCTTTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152606.2-563s1c1
Sequence:CCGGCGGTTTGTTATCCAGGCATAACTCGAGTTATGCCTGGATAACAAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152606.2-1923s1c1
Sequence:CCGGGCCTTTATTCGTAGAGGGAATCTCGAGATTCCCTCTACGAATAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152606.2-574s1c1
Sequence:CCGGCCAGGCATAAGACCAAGAAATCTCGAGATTTCTTGGTCTTATGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152606.2-1756s1c1
Sequence:CCGGCCTTTCGAGTTCGTTCTCAAACTCGAGTTTGAGAACGAACTCGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152606
ZNF540 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 540
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152606.2-1518s21c1
Sequence:CCGGGGACAGCTTAATCGGCATAAACTCGAGTTTATGCCGATTAAGCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152606.2-1928s21c1
Sequence:CCGGTATTCGTAGAGGGAATCTTAACTCGAGTTAAGATTCCCTCTACGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152606.2-664s21c1
Sequence:CCGGTTCGTCTGAAAGGATCCATTTCTCGAGAAATGGATCCTTTCAGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152606.2-2329s21c1
Sequence:CCGGTTCCATGTCATGCTCTATTTACTCGAGTAAATAGAGCATGACATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152606.2-628s21c1
Sequence:CCGGTATCCAAAGAGAGTATAATAGCTCGAGCTATTATACTCTCTTTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152606.2-563s1c1
Sequence:CCGGCGGTTTGTTATCCAGGCATAACTCGAGTTATGCCTGGATAACAAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152606.2-1923s1c1
Sequence:CCGGGCCTTTATTCGTAGAGGGAATCTCGAGATTCCCTCTACGAATAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152606.2-574s1c1
Sequence:CCGGCCAGGCATAAGACCAAGAAATCTCGAGATTTCTTGGTCTTATGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152606.2-1756s1c1
Sequence:CCGGCCTTTCGAGTTCGTTCTCAAACTCGAGTTTGAGAACGAACTCGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152606
ZNF540 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 540
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152606.2-1518s21c1
Sequence:CCGGGGACAGCTTAATCGGCATAAACTCGAGTTTATGCCGATTAAGCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152606.2-1928s21c1
Sequence:CCGGTATTCGTAGAGGGAATCTTAACTCGAGTTAAGATTCCCTCTACGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152606.2-664s21c1
Sequence:CCGGTTCGTCTGAAAGGATCCATTTCTCGAGAAATGGATCCTTTCAGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152606.2-2329s21c1
Sequence:CCGGTTCCATGTCATGCTCTATTTACTCGAGTAAATAGAGCATGACATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152606.2-628s21c1
Sequence:CCGGTATCCAAAGAGAGTATAATAGCTCGAGCTATTATACTCTCTTTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152606.2-563s1c1
Sequence:CCGGCGGTTTGTTATCCAGGCATAACTCGAGTTATGCCTGGATAACAAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152606.2-1923s1c1
Sequence:CCGGGCCTTTATTCGTAGAGGGAATCTCGAGATTCCCTCTACGAATAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152606.2-574s1c1
Sequence:CCGGCCAGGCATAAGACCAAGAAATCTCGAGATTTCTTGGTCTTATGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152606.2-1756s1c1
Sequence:CCGGCCTTTCGAGTTCGTTCTCAAACTCGAGTTTGAGAACGAACTCGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks