EMAIL THIS PAGE TO A FRIEND

ZNF541

zinc finger protein 541

UniProtKB ID: Q9H0D2, Q8NDK8
Gene ID:
chicken(100858546) zinc finger protein 541
Horse(100071261) zinc finger protein 541
domestic cat(101097362) zinc finger protein 541
dog(484419) zinc finger protein 541
cow(527061) zinc finger protein 541
sheep(101102668) zinc finger protein 541
naked mole-rat(101707698) zinc finger protein 541
domestic guinea pig(100729612) zinc finger protein 541
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032255 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152081 MISSION® esiRNA esiRNA human ZNF541 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032255 Rosetta Predictions human pricing
XM_001716969 Rosetta Predictions human pricing
XM_001717930 Rosetta Predictions human pricing
XM_001718013 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193298 predicted 628
2 SASI_Hs01_00193299 predicted 1515
3 SASI_Hs01_00193300 predicted 2118
4 SASI_Hs01_00193301 predicted 1893
5 SASI_Hs01_00193302 predicted 1579
6 SASI_Hs01_00193303 predicted 1917
7 SASI_Hs01_00193304 predicted 2282
8 SASI_Hs01_00193305 predicted 323
9 SASI_Hs01_00193306 predicted 378
10 SASI_Hs01_00193307 predicted 2132
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00414154 predicted 2248
2 SASI_Hs02_00414155 predicted 325
3 SASI_Hs02_00414156 predicted 2254
4 SASI_Hs02_00414157 predicted 3694
5 SASI_Hs02_00414158 predicted 3377
6 SASI_Hs02_00414159 predicted 830
7 SASI_Hs02_00414160 predicted 244
8 SASI_Hs02_00414161 predicted 4084
9 SASI_Hs02_00414162 predicted 2902
10 SASI_Hs02_00414163 predicted 1944
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00420518 predicted 2255
2 SASI_Hs02_00420519 predicted 3317
3 SASI_Hs02_00420520 predicted 2252
4 SASI_Hs02_00420521 predicted 3696
5 SASI_Hs02_00420522 predicted 4145
6 SASI_Hs02_00420523 predicted 3379
7 SASI_Hs02_00420524 predicted 3719
8 SASI_Hs02_00420525 predicted 4080
9 SASI_Hs02_00420526 predicted 1946
10 SASI_Hs02_00420527 predicted 2005
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00421121 predicted 2256
2 SASI_Hs02_00421122 predicted 323
3 SASI_Hs02_00421123 predicted 2250
4 SASI_Hs02_00421124 predicted 3696
5 SASI_Hs02_00421125 predicted 3378
6 SASI_Hs02_00421126 predicted 833
7 SASI_Hs02_00421127 predicted 240
8 SASI_Hs02_00421128 predicted 4079
9 SASI_Hs02_00421129 predicted 2902
10 SASI_Hs02_00421130 predicted 4059
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032255
ZNF541 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 541
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032255.1-2746s1c1
Sequence:CCGGGTTTGGTTTCATGTGTTAGATCTCGAGATCTAACACATGAAACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032255.1-2264s1c1
Sequence:CCGGGACAAGATCAAGAGTCGAAATCTCGAGATTTCGACTCTTGATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032255.1-797s1c1
Sequence:CCGGCATCCGGTGAAGGAAGAGAATCTCGAGATTCTCTTCCTTCACCGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032255.1-738s1c1
Sequence:CCGGCCAAGTCCAAGCTGACAATATCTCGAGATATTGTCAGCTTGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032255.1-2125s1c1
Sequence:CCGGCAAGTTAAAGACCAAGAGTTACTCGAGTAACTCTTGGTCTTTAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032255
ZNF541 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 541
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032255.1-2746s1c1
Sequence:CCGGGTTTGGTTTCATGTGTTAGATCTCGAGATCTAACACATGAAACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032255.1-2264s1c1
Sequence:CCGGGACAAGATCAAGAGTCGAAATCTCGAGATTTCGACTCTTGATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032255.1-797s1c1
Sequence:CCGGCATCCGGTGAAGGAAGAGAATCTCGAGATTCTCTTCCTTCACCGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032255.1-738s1c1
Sequence:CCGGCCAAGTCCAAGCTGACAATATCTCGAGATATTGTCAGCTTGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032255.1-2125s1c1
Sequence:CCGGCAAGTTAAAGACCAAGAGTTACTCGAGTAACTCTTGGTCTTTAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032255
ZNF541 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 541
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032255.1-2746s1c1
Sequence:CCGGGTTTGGTTTCATGTGTTAGATCTCGAGATCTAACACATGAAACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032255.1-2264s1c1
Sequence:CCGGGACAAGATCAAGAGTCGAAATCTCGAGATTTCGACTCTTGATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032255.1-797s1c1
Sequence:CCGGCATCCGGTGAAGGAAGAGAATCTCGAGATTCTCTTCCTTCACCGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032255.1-738s1c1
Sequence:CCGGCCAAGTCCAAGCTGACAATATCTCGAGATATTGTCAGCTTGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032255.1-2125s1c1
Sequence:CCGGCAAGTTAAAGACCAAGAGTTACTCGAGTAACTCTTGGTCTTTAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks