EMAIL THIS PAGE TO A FRIEND

ZNF542

zinc finger protein 542

Species: Human ZNF542(147947)
UniProtKB ID: Q5EBM4, B3KUG2, B4DLV1, Q6N061
Gene ID:
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194319 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194319 Rosetta Predictions human pricing
NR_003127 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039191 predicted 1304
2 SASI_Hs01_00039192 predicted 1110
3 SASI_Hs01_00039193 predicted 1055
4 SASI_Hs01_00039194 predicted 1140
5 SASI_Hs01_00039195 predicted 1308
6 SASI_Hs01_00039196 predicted 1153
7 SASI_Hs01_00039197 predicted 971
8 SASI_Hs01_00039198 predicted 908
9 SASI_Hs01_00039199 predicted 903
10 SASI_Hs01_00039200 predicted 1390
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378326 predicted 1165
2 SASI_Hs02_00378327 predicted 7655
3 SASI_Hs02_00378328 predicted 8219
4 SASI_Hs02_00378329 predicted 1632
5 SASI_Hs02_00378330 predicted 7820
6 SASI_Hs02_00378331 predicted 469
7 SASI_Hs02_00378332 predicted 1378
8 SASI_Hs02_00378333 predicted 7998
9 SASI_Hs02_00378334 predicted 4967
10 SASI_Hs02_00378335 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194319
ZNF542 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 542
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194319.1-1865s1c1
Sequence:CCGGCCCTAATGTAAATGACGAGTTCTCGAGAACTCGTCATTTACATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194319.1-1479s1c1
Sequence:CCGGTCCACACTTTGTCAACATAATCTCGAGATTATGTTGACAAAGTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194319.1-981s1c1
Sequence:CCGGCTTATAGATCACCAGCGAATTCTCGAGAATTCGCTGGTGATCTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194319.1-1147s1c1
Sequence:CCGGCCCTGATTGAACATTGGAGAACTCGAGTTCTCCAATGTTCAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194319.1-1480s1c1
Sequence:CCGGCCACACTTTGTCAACATAATACTCGAGTATTATGTTGACAAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194319
ZNF542 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 542
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194319.1-1865s1c1
Sequence:CCGGCCCTAATGTAAATGACGAGTTCTCGAGAACTCGTCATTTACATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194319.1-1479s1c1
Sequence:CCGGTCCACACTTTGTCAACATAATCTCGAGATTATGTTGACAAAGTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194319.1-981s1c1
Sequence:CCGGCTTATAGATCACCAGCGAATTCTCGAGAATTCGCTGGTGATCTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194319.1-1147s1c1
Sequence:CCGGCCCTGATTGAACATTGGAGAACTCGAGTTCTCCAATGTTCAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194319.1-1480s1c1
Sequence:CCGGCCACACTTTGTCAACATAATACTCGAGTATTATGTTGACAAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194319
ZNF542 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 542
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194319.1-1865s1c1
Sequence:CCGGCCCTAATGTAAATGACGAGTTCTCGAGAACTCGTCATTTACATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194319.1-1479s1c1
Sequence:CCGGTCCACACTTTGTCAACATAATCTCGAGATTATGTTGACAAAGTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194319.1-981s1c1
Sequence:CCGGCTTATAGATCACCAGCGAATTCTCGAGAATTCGCTGGTGATCTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194319.1-1147s1c1
Sequence:CCGGCCCTGATTGAACATTGGAGAACTCGAGTTCTCCAATGTTCAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194319.1-1480s1c1
Sequence:CCGGCCACACTTTGTCAACATAATACTCGAGTATTATGTTGACAAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks