EMAIL THIS PAGE TO A FRIEND

ZNF543

zinc finger protein 543

Species: Human ZNF543(125919), domestic guinea pig Znf543(100718160), Domestic Rabbit ZNF543(100344112), cow ZNF543(100296050)
UniProtKB ID: Q08ER8, Q495U9, Q495V0, Q6ZMP4, Q8NCX4
Gene ID:
domestic guinea pig(100718160) zinc finger protein 543
Domestic Rabbit(100344112) zinc finger protein 543
cow(100296050) zinc finger protein 543
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_064865 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_064865 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_064865 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027101 MISSION® esiRNA esiRNA human ZNF543 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_213598 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229998 predicted 905
2 SASI_Hs01_00230000 predicted 690
3 SASI_Hs01_00230001 predicted 884
4 SASI_Hs01_00230002 predicted 868
5 SASI_Hs01_00230003 predicted 536
6 SASI_Hs01_00230004 predicted 1383
7 SASI_Hs02_00374273 predicted 671
8 SASI_Hs01_00230006 predicted 1996
9 SASI_Hs01_00230007 predicted 2136
10 SASI_Hs02_00374274 predicted 943
11 SASI_Hs01_00229999 predicted 1990
12 SASI_Hs01_00230005 predicted 1009
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_064865
ZNF543 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 543
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_064865.6-1825s1c1
Sequence:CCGGGCCATTCACACTGAAGAGAAACTCGAGTTTCTCTTCAGTGTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064865.6-541s1c1
Sequence:CCGGTGTGATTCACATGGACCAGTTCTCGAGAACTGGTCCATGTGAATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064865.6-1688s1c1
Sequence:CCGGCCATTGTAACAGATGTGGGAACTCGAGTTCCCACATCTGTTACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064865.6-333s1c1
Sequence:CCGGAGCCTCAAAGAACTCCCAATTCTCGAGAATTGGGAGTTCTTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064865.6-334s1c1
Sequence:CCGGGCCTCAAAGAACTCCCAATTACTCGAGTAATTGGGAGTTCTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_064865
ZNF543 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 543
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_064865.6-1825s1c1
Sequence:CCGGGCCATTCACACTGAAGAGAAACTCGAGTTTCTCTTCAGTGTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064865.6-541s1c1
Sequence:CCGGTGTGATTCACATGGACCAGTTCTCGAGAACTGGTCCATGTGAATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064865.6-1688s1c1
Sequence:CCGGCCATTGTAACAGATGTGGGAACTCGAGTTCCCACATCTGTTACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064865.6-333s1c1
Sequence:CCGGAGCCTCAAAGAACTCCCAATTCTCGAGAATTGGGAGTTCTTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064865.6-334s1c1
Sequence:CCGGGCCTCAAAGAACTCCCAATTACTCGAGTAATTGGGAGTTCTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_064865
ZNF543 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 543
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_064865.6-1825s1c1
Sequence:CCGGGCCATTCACACTGAAGAGAAACTCGAGTTTCTCTTCAGTGTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064865.6-541s1c1
Sequence:CCGGTGTGATTCACATGGACCAGTTCTCGAGAACTGGTCCATGTGAATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064865.6-1688s1c1
Sequence:CCGGCCATTGTAACAGATGTGGGAACTCGAGTTCCCACATCTGTTACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064865.6-333s1c1
Sequence:CCGGAGCCTCAAAGAACTCCCAATTCTCGAGAATTGGGAGTTCTTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064865.6-334s1c1
Sequence:CCGGGCCTCAAAGAACTCCCAATTACTCGAGTAATTGGGAGTTCTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks