EMAIL THIS PAGE TO A FRIEND

ZNF544

zinc finger protein 544

UniProtKB ID: Q6NX49, A8K6J1, Q9UEX4
Gene ID:
Horse(100064248) zinc finger protein 544
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA002732 Anti-ZNF544 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014480 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014480 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080094 predicted 1977
2 SASI_Hs01_00080095 predicted 1648
3 SASI_Hs01_00080097 predicted 1723
4 SASI_Hs01_00080098 predicted 1193
5 SASI_Hs01_00080099 predicted 991
6 SASI_Hs01_00080100 predicted 1567
7 SASI_Hs02_00345723 predicted 2714
8 SASI_Hs01_00080101 predicted 1894
9 SASI_Hs02_00345724 predicted 1271
10 SASI_Hs01_00080102 predicted 1685
11 SASI_Hs01_00080096 predicted 921
12 SASI_Hs01_00080103 predicted 2267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014480
ZNF544 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 544
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014480.1-2745s1c1
Sequence:CCGGCCAGTTATGATACTTTCCTTACTCGAGTAAGGAAAGTATCATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014480.1-2008s1c1
Sequence:CCGGGCTATCGGTTAGTTGCACATACTCGAGTATGTGCAACTAACCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014480.1-904s1c1
Sequence:CCGGGAGCTTTCTGTCAGAGTATTTCTCGAGAAATACTCTGACAGAAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014480.1-798s1c1
Sequence:CCGGCCTAAGCCCAACTCACAAGTTCTCGAGAACTTGTGAGTTGGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014480.1-1666s1c1
Sequence:CCGGGCCAAAGCTATGAGTTAGTTACTCGAGTAACTAACTCATAGCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014480.2-2704s21c1
Sequence:CCGGTATCAGTGTGACGTGTATTAACTCGAGTTAATACACGTCACACTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014480.2-2891s21c1
Sequence:CCGGTAGCCAACGGTGTCAACTTACCTCGAGGTAAGTTGACACCGTTGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014480.2-2811s21c1
Sequence:CCGGGATCGCTCAACCCTTAGTAAACTCGAGTTTACTAAGGGTTGAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014480.2-1161s21c1
Sequence:CCGGTAAACTTGGAAACGTTGAAACCTCGAGGTTTCAACGTTTCCAAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014480
ZNF544 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 544
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014480.1-2745s1c1
Sequence:CCGGCCAGTTATGATACTTTCCTTACTCGAGTAAGGAAAGTATCATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014480.1-2008s1c1
Sequence:CCGGGCTATCGGTTAGTTGCACATACTCGAGTATGTGCAACTAACCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014480.1-904s1c1
Sequence:CCGGGAGCTTTCTGTCAGAGTATTTCTCGAGAAATACTCTGACAGAAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014480.1-798s1c1
Sequence:CCGGCCTAAGCCCAACTCACAAGTTCTCGAGAACTTGTGAGTTGGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014480.1-1666s1c1
Sequence:CCGGGCCAAAGCTATGAGTTAGTTACTCGAGTAACTAACTCATAGCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014480.2-2704s21c1
Sequence:CCGGTATCAGTGTGACGTGTATTAACTCGAGTTAATACACGTCACACTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014480.2-2891s21c1
Sequence:CCGGTAGCCAACGGTGTCAACTTACCTCGAGGTAAGTTGACACCGTTGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014480.2-2811s21c1
Sequence:CCGGGATCGCTCAACCCTTAGTAAACTCGAGTTTACTAAGGGTTGAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014480.2-1161s21c1
Sequence:CCGGTAAACTTGGAAACGTTGAAACCTCGAGGTTTCAACGTTTCCAAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014480
ZNF544 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 544
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014480.1-2745s1c1
Sequence:CCGGCCAGTTATGATACTTTCCTTACTCGAGTAAGGAAAGTATCATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014480.1-2008s1c1
Sequence:CCGGGCTATCGGTTAGTTGCACATACTCGAGTATGTGCAACTAACCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014480.1-904s1c1
Sequence:CCGGGAGCTTTCTGTCAGAGTATTTCTCGAGAAATACTCTGACAGAAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014480.1-798s1c1
Sequence:CCGGCCTAAGCCCAACTCACAAGTTCTCGAGAACTTGTGAGTTGGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014480.1-1666s1c1
Sequence:CCGGGCCAAAGCTATGAGTTAGTTACTCGAGTAACTAACTCATAGCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014480.2-2704s21c1
Sequence:CCGGTATCAGTGTGACGTGTATTAACTCGAGTTAATACACGTCACACTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014480.2-2891s21c1
Sequence:CCGGTAGCCAACGGTGTCAACTTACCTCGAGGTAAGTTGACACCGTTGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014480.2-2811s21c1
Sequence:CCGGGATCGCTCAACCCTTAGTAAACTCGAGTTTACTAAGGGTTGAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014480.2-1161s21c1
Sequence:CCGGTAAACTTGGAAACGTTGAAACCTCGAGGTTTCAACGTTTCCAAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks