EMAIL THIS PAGE TO A FRIEND

ZNF546

zinc finger protein 546

Synonyms: ZNF49
UniProtKB ID: Q86UE3, A8K913
Gene ID:
Horse(100067786) zinc finger protein 546
cow(100848151) zinc finger protein 546
sheep(101118470) zinc finger protein 546
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178544 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178544 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178544 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040061 MISSION® esiRNA esiRNA human ZNF546 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178544 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174006 predicted 2181
2 SASI_Hs01_00174007 predicted 1527
3 SASI_Hs01_00174008 predicted 2659
4 SASI_Hs01_00174009 predicted 2615
5 SASI_Hs01_00174010 predicted 329
6 SASI_Hs01_00174011 predicted 2282
7 SASI_Hs02_00369779 predicted 1779
8 SASI_Hs01_00174012 predicted 511
9 SASI_Hs01_00174013 predicted 1174
10 SASI_Hs01_00174014 predicted 1256
11 SASI_Hs01_00174015 predicted 944
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178544
ZNF546 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 546
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178544.3-2861s21c1
Sequence:CCGGTTACTTCATGCTCACAATTTACTCGAGTAAATTGTGAGCATGAAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178544.3-823s21c1
Sequence:CCGGGATGGGATGCGTTAGTCAAATCTCGAGATTTGACTAACGCATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178544.3-2698s21c1
Sequence:CCGGTATTCGTAGTGATCAACTTACCTCGAGGTAAGTTGATCACTACGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178544.2-3555s1c1
Sequence:CCGGGCTCTTGGTATCTATAACTTTCTCGAGAAAGTTATAGATACCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178544.2-2364s1c1
Sequence:CCGGCGTCGGTATCATCTTACTCAACTCGAGTTGAGTAAGATGATACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178544.2-197s1c1
Sequence:CCGGGCCTCCAAATGACTTTCTCATCTCGAGATGAGAAAGTCATTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178544.2-1944s1c1
Sequence:CCGGCGTCGCTATAATCTTACTCAACTCGAGTTGAGTAAGATTATAGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178544.2-2196s1c1
Sequence:CCGGCGGCACTATCATCTTACTCAACTCGAGTTGAGTAAGATGATAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178544
ZNF546 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 546
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178544.3-2861s21c1
Sequence:CCGGTTACTTCATGCTCACAATTTACTCGAGTAAATTGTGAGCATGAAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178544.3-823s21c1
Sequence:CCGGGATGGGATGCGTTAGTCAAATCTCGAGATTTGACTAACGCATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178544.3-2698s21c1
Sequence:CCGGTATTCGTAGTGATCAACTTACCTCGAGGTAAGTTGATCACTACGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178544.2-3555s1c1
Sequence:CCGGGCTCTTGGTATCTATAACTTTCTCGAGAAAGTTATAGATACCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178544.2-2364s1c1
Sequence:CCGGCGTCGGTATCATCTTACTCAACTCGAGTTGAGTAAGATGATACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178544.2-197s1c1
Sequence:CCGGGCCTCCAAATGACTTTCTCATCTCGAGATGAGAAAGTCATTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178544.2-1944s1c1
Sequence:CCGGCGTCGCTATAATCTTACTCAACTCGAGTTGAGTAAGATTATAGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178544.2-2196s1c1
Sequence:CCGGCGGCACTATCATCTTACTCAACTCGAGTTGAGTAAGATGATAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178544
ZNF546 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 546
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178544.3-2861s21c1
Sequence:CCGGTTACTTCATGCTCACAATTTACTCGAGTAAATTGTGAGCATGAAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178544.3-823s21c1
Sequence:CCGGGATGGGATGCGTTAGTCAAATCTCGAGATTTGACTAACGCATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178544.3-2698s21c1
Sequence:CCGGTATTCGTAGTGATCAACTTACCTCGAGGTAAGTTGATCACTACGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178544.2-3555s1c1
Sequence:CCGGGCTCTTGGTATCTATAACTTTCTCGAGAAAGTTATAGATACCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178544.2-2364s1c1
Sequence:CCGGCGTCGGTATCATCTTACTCAACTCGAGTTGAGTAAGATGATACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178544.2-197s1c1
Sequence:CCGGGCCTCCAAATGACTTTCTCATCTCGAGATGAGAAAGTCATTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178544.2-1944s1c1
Sequence:CCGGCGTCGCTATAATCTTACTCAACTCGAGTTGAGTAAGATTATAGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178544.2-2196s1c1
Sequence:CCGGCGGCACTATCATCTTACTCAACTCGAGTTGAGTAAGATGATAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks