EMAIL THIS PAGE TO A FRIEND

ZNF547

zinc finger protein 547

UniProtKB ID: Q8IVP9, A8K5Z9, Q96NC4
Gene ID:
cow(101906416) zinc finger protein 547
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173631 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117071 MISSION® esiRNA esiRNA human ZNF547 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173631 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200353 predicted 635
2 SASI_Hs01_00200354 predicted 1394
3 SASI_Hs01_00200355 predicted 1300
4 SASI_Hs01_00200356 predicted 327
5 SASI_Hs01_00200358 predicted 1178
6 SASI_Hs01_00200359 predicted 1024
7 SASI_Hs01_00200360 predicted 1402
8 SASI_Hs01_00200361 predicted 1355
9 SASI_Hs01_00200362 predicted 679
10 SASI_Hs02_00368512 predicted 845
11 SASI_Hs01_00200357 predicted 1340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173631
ZNF547 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 547
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173631.2-1276s1c1
Sequence:CCGGCCTTACAAAGTCCCACCTCATCTCGAGATGAGGTGGGACTTTGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173631.2-429s1c1
Sequence:CCGGCCTGTCTATCTACCCAGAATACTCGAGTATTCTGGGTAGATAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173631.2-1026s1c1
Sequence:CCGGAGTGCAACTCAAACCTCTTTACTCGAGTAAAGAGGTTTGAGTTGCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173631.2-1292s1c1
Sequence:CCGGCTCATTTGTCATCAGACAGTTCTCGAGAACTGTCTGATGACAAATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173631.2-1180s1c1
Sequence:CCGGTGGGAAATTCTTCAGCTTGAACTCGAGTTCAAGCTGAAGAATTTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173631.2-602s21c1
Sequence:CCGGGATGGAGGAAGACCGACATTTCTCGAGAAATGTCGGTCTTCCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173631.2-1392s21c1
Sequence:CCGGACACTGGATAAGGCCCTTATGCTCGAGCATAAGGGCCTTATCCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173631.2-1432s21c1
Sequence:CCGGAGCCTTCAGTCACCAACATATCTCGAGATATGTTGGTGACTGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173631
ZNF547 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 547
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173631.2-1276s1c1
Sequence:CCGGCCTTACAAAGTCCCACCTCATCTCGAGATGAGGTGGGACTTTGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173631.2-429s1c1
Sequence:CCGGCCTGTCTATCTACCCAGAATACTCGAGTATTCTGGGTAGATAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173631.2-1026s1c1
Sequence:CCGGAGTGCAACTCAAACCTCTTTACTCGAGTAAAGAGGTTTGAGTTGCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173631.2-1292s1c1
Sequence:CCGGCTCATTTGTCATCAGACAGTTCTCGAGAACTGTCTGATGACAAATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173631.2-1180s1c1
Sequence:CCGGTGGGAAATTCTTCAGCTTGAACTCGAGTTCAAGCTGAAGAATTTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173631.2-602s21c1
Sequence:CCGGGATGGAGGAAGACCGACATTTCTCGAGAAATGTCGGTCTTCCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173631.2-1392s21c1
Sequence:CCGGACACTGGATAAGGCCCTTATGCTCGAGCATAAGGGCCTTATCCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173631.2-1432s21c1
Sequence:CCGGAGCCTTCAGTCACCAACATATCTCGAGATATGTTGGTGACTGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173631
ZNF547 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 547
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173631.2-1276s1c1
Sequence:CCGGCCTTACAAAGTCCCACCTCATCTCGAGATGAGGTGGGACTTTGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173631.2-429s1c1
Sequence:CCGGCCTGTCTATCTACCCAGAATACTCGAGTATTCTGGGTAGATAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173631.2-1026s1c1
Sequence:CCGGAGTGCAACTCAAACCTCTTTACTCGAGTAAAGAGGTTTGAGTTGCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173631.2-1292s1c1
Sequence:CCGGCTCATTTGTCATCAGACAGTTCTCGAGAACTGTCTGATGACAAATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173631.2-1180s1c1
Sequence:CCGGTGGGAAATTCTTCAGCTTGAACTCGAGTTCAAGCTGAAGAATTTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173631.2-602s21c1
Sequence:CCGGGATGGAGGAAGACCGACATTTCTCGAGAAATGTCGGTCTTCCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173631.2-1392s21c1
Sequence:CCGGACACTGGATAAGGCCCTTATGCTCGAGCATAAGGGCCTTATCCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173631.2-1432s21c1
Sequence:CCGGAGCCTTCAGTCACCAACATATCTCGAGATATGTTGGTGACTGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks