EMAIL THIS PAGE TO A FRIEND

ZNF548

zinc finger protein 548

UniProtKB ID: Q8NEK5, Q96M05
Gene ID:
cow(504913) zinc finger protein 548
sheep(101107463) zinc finger protein 548
domestic guinea pig(101789305) zinc finger protein 548
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152909 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071501 MISSION® esiRNA esiRNA human ZNF548 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152909 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076019 predicted 676
2 SASI_Hs01_00076020 predicted 1535
3 SASI_Hs01_00076021 predicted 611
4 SASI_Hs01_00076022 predicted 683
5 SASI_Hs01_00076023 predicted 1526
6 SASI_Hs01_00076024 predicted 1288
7 SASI_Hs01_00076025 predicted 1104
8 SASI_Hs01_00076026 predicted 558
9 SASI_Hs01_00076027 predicted 1372
10 SASI_Hs01_00076028 predicted 984
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152909
ZNF548 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 548
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152909.2-1984s21c1
Sequence:CCGGCCCAGAAATGTCTCAACTATACTCGAGTATAGTTGAGACATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152909.2-2007s21c1
Sequence:CCGGTCTATACTCTATGGTACTTATCTCGAGATAAGTACCATAGAGTATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152909.2-1837s21c1
Sequence:CCGGGAAAGTTTACCATTGACTATTCTCGAGAATAGTCAATGGTAAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152909.2-1528s1c1
Sequence:CCGGCGGGAAATTCTTTCGTTACAACTCGAGTTGTAACGAAAGAATTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152909.2-614s1c1
Sequence:CCGGCCAAAGCAGCAAATTGGAGAACTCGAGTTCTCCAATTTGCTGCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152909.2-454s1c1
Sequence:CCGGGTCAGAGGTTACAACTTCAAACTCGAGTTTGAAGTTGTAACCTCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152909.2-1387s1c1
Sequence:CCGGCCTTGTTAAACATTGGAGAAACTCGAGTTTCTCCAATGTTTAACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152909.2-1117s1c1
Sequence:CCGGCTTTCGGTACAGCTCCACATTCTCGAGAATGTGGAGCTGTACCGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152909
ZNF548 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 548
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152909.2-1984s21c1
Sequence:CCGGCCCAGAAATGTCTCAACTATACTCGAGTATAGTTGAGACATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152909.2-2007s21c1
Sequence:CCGGTCTATACTCTATGGTACTTATCTCGAGATAAGTACCATAGAGTATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152909.2-1837s21c1
Sequence:CCGGGAAAGTTTACCATTGACTATTCTCGAGAATAGTCAATGGTAAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152909.2-1528s1c1
Sequence:CCGGCGGGAAATTCTTTCGTTACAACTCGAGTTGTAACGAAAGAATTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152909.2-614s1c1
Sequence:CCGGCCAAAGCAGCAAATTGGAGAACTCGAGTTCTCCAATTTGCTGCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152909.2-454s1c1
Sequence:CCGGGTCAGAGGTTACAACTTCAAACTCGAGTTTGAAGTTGTAACCTCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152909.2-1387s1c1
Sequence:CCGGCCTTGTTAAACATTGGAGAAACTCGAGTTTCTCCAATGTTTAACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152909.2-1117s1c1
Sequence:CCGGCTTTCGGTACAGCTCCACATTCTCGAGAATGTGGAGCTGTACCGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152909
ZNF548 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 548
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152909.2-1984s21c1
Sequence:CCGGCCCAGAAATGTCTCAACTATACTCGAGTATAGTTGAGACATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152909.2-2007s21c1
Sequence:CCGGTCTATACTCTATGGTACTTATCTCGAGATAAGTACCATAGAGTATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152909.2-1837s21c1
Sequence:CCGGGAAAGTTTACCATTGACTATTCTCGAGAATAGTCAATGGTAAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152909.2-1528s1c1
Sequence:CCGGCGGGAAATTCTTTCGTTACAACTCGAGTTGTAACGAAAGAATTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152909.2-614s1c1
Sequence:CCGGCCAAAGCAGCAAATTGGAGAACTCGAGTTCTCCAATTTGCTGCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152909.2-454s1c1
Sequence:CCGGGTCAGAGGTTACAACTTCAAACTCGAGTTTGAAGTTGTAACCTCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152909.2-1387s1c1
Sequence:CCGGCCTTGTTAAACATTGGAGAAACTCGAGTTTCTCCAATGTTTAACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152909.2-1117s1c1
Sequence:CCGGCTTTCGGTACAGCTCCACATTCTCGAGAATGTGGAGCTGTACCGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks