EMAIL THIS PAGE TO A FRIEND

ZNF549

zinc finger protein 549

Species: Human ZNF549(256051)
UniProtKB ID: Q6P9A3, B3KV91, O43336, Q8NAR4
Gene ID:
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153263 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025751 MISSION® esiRNA esiRNA human ZNF549 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153263 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236917 predicted 1042
2 SASI_Hs01_00236918 predicted 2099
3 SASI_Hs01_00236919 predicted 2204
4 SASI_Hs01_00236920 predicted 2216
5 SASI_Hs01_00236921 predicted 1730
6 SASI_Hs01_00236922 predicted 1777
7 SASI_Hs02_00367133 predicted 580
8 SASI_Hs02_00367134 predicted 1579
9 SASI_Hs01_00236923 predicted 836
10 SASI_Hs01_00236924 predicted 1955
11 SASI_Hs01_00236916 predicted 1414
12 SASI_Hs01_00236925 predicted 1330
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153263
ZNF549 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 549
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153263.1-1234s1c1
Sequence:CCGGCGCCACAAACAAACATTTGTTCTCGAGAACAAATGTTTGTTTGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153263.1-756s1c1
Sequence:CCGGCCCATGCAAAGATGTTGAGAACTCGAGTTCTCAACATCTTTGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153263.1-871s1c1
Sequence:CCGGCGTTACAAATGTGAGCAAGTTCTCGAGAACTTGCTCACATTTGTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153263.1-406s1c1
Sequence:CCGGGTAGGTTGTTTGCATGGAATACTCGAGTATTCCATGCAAACAACCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153263.1-1550s1c1
Sequence:CCGGGCATCATATGTGGGAAATCATCTCGAGATGATTTCCCACATATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153263
ZNF549 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 549
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153263.1-1234s1c1
Sequence:CCGGCGCCACAAACAAACATTTGTTCTCGAGAACAAATGTTTGTTTGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153263.1-756s1c1
Sequence:CCGGCCCATGCAAAGATGTTGAGAACTCGAGTTCTCAACATCTTTGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153263.1-871s1c1
Sequence:CCGGCGTTACAAATGTGAGCAAGTTCTCGAGAACTTGCTCACATTTGTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153263.1-406s1c1
Sequence:CCGGGTAGGTTGTTTGCATGGAATACTCGAGTATTCCATGCAAACAACCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153263.1-1550s1c1
Sequence:CCGGGCATCATATGTGGGAAATCATCTCGAGATGATTTCCCACATATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153263
ZNF549 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 549
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153263.1-1234s1c1
Sequence:CCGGCGCCACAAACAAACATTTGTTCTCGAGAACAAATGTTTGTTTGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153263.1-756s1c1
Sequence:CCGGCCCATGCAAAGATGTTGAGAACTCGAGTTCTCAACATCTTTGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153263.1-871s1c1
Sequence:CCGGCGTTACAAATGTGAGCAAGTTCTCGAGAACTTGCTCACATTTGTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153263.1-406s1c1
Sequence:CCGGGTAGGTTGTTTGCATGGAATACTCGAGTATTCCATGCAAACAACCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153263.1-1550s1c1
Sequence:CCGGGCATCATATGTGGGAAATCATCTCGAGATGATTTCCCACATATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks