EMAIL THIS PAGE TO A FRIEND

ZNF550

zinc finger protein 550

UniProtKB ID: Q7Z398, B3KVF6, O43337, Q7Z6D7, Q8NE45
Gene ID:
domestic cat(101097606) zinc finger protein 550
dog(484257) zinc finger protein 550
domestic guinea pig(100719272) zinc finger protein 550
naked mole-rat(101711648) zinc finger protein 550
cow(100298980) zinc finger protein 550
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153231 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039654 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039654 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039654 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060081 MISSION® esiRNA esiRNA human ZNF550 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039654 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220527 predicted 906
2 SASI_Hs01_00220528 predicted 858
3 SASI_Hs01_00220529 predicted 520
4 SASI_Hs01_00220530 predicted 647
5 SASI_Hs01_00220531 predicted 603
6 SASI_Hs01_00220532 predicted 847
7 SASI_Hs01_00220533 predicted 457
8 SASI_Hs01_00220534 predicted 670
9 SASI_Hs01_00220535 predicted 208
10 SASI_Hs02_00308619 predicted 399
11 SASI_Hs01_00220536 predicted 337
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153231
VALIDATED
ZNF550 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 550
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153231.2-2111s1c1
Sequence:CCGGGCTGTCATCAAAGGGTTCTTTCTCGAGAAAGAACCCTTTGATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_153231.2-1138s1c1
Sequence:CCGGCCCACCTAATTCAACATTACACTCGAGTGTAATGTTGAATTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153231.2-666s1c1
Sequence:CCGGAGGGCATTACAAGAGTGGTTACTCGAGTAACCACTCTTGTAATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153231.2-1139s1c1
Sequence:CCGGCCACCTAATTCAACATTACATCTCGAGATGTAATGTTGAATTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153231.2-736s1c1
Sequence:CCGGCCTTGATTCATGCAGGGACAACTCGAGTTGTCCCTGCATGAATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153231
VALIDATED
ZNF550 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 550
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153231.2-2111s1c1
Sequence:CCGGGCTGTCATCAAAGGGTTCTTTCTCGAGAAAGAACCCTTTGATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_153231.2-1138s1c1
Sequence:CCGGCCCACCTAATTCAACATTACACTCGAGTGTAATGTTGAATTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153231.2-666s1c1
Sequence:CCGGAGGGCATTACAAGAGTGGTTACTCGAGTAACCACTCTTGTAATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153231.2-1139s1c1
Sequence:CCGGCCACCTAATTCAACATTACATCTCGAGATGTAATGTTGAATTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153231.2-736s1c1
Sequence:CCGGCCTTGATTCATGCAGGGACAACTCGAGTTGTCCCTGCATGAATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153231
VALIDATED
ZNF550 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 550
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153231.2-2111s1c1
Sequence:CCGGGCTGTCATCAAAGGGTTCTTTCTCGAGAAAGAACCCTTTGATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_153231.2-1138s1c1
Sequence:CCGGCCCACCTAATTCAACATTACACTCGAGTGTAATGTTGAATTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153231.2-666s1c1
Sequence:CCGGAGGGCATTACAAGAGTGGTTACTCGAGTAACCACTCTTGTAATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153231.2-1139s1c1
Sequence:CCGGCCACCTAATTCAACATTACATCTCGAGATGTAATGTTGAATTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153231.2-736s1c1
Sequence:CCGGCCTTGATTCATGCAGGGACAACTCGAGTTGTCCCTGCATGAATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039654
ZNF550 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 550
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039654.1-161s21c1
Sequence:CCGGCCACTTACCCGCCAGTCTTATCTCGAGATAAGACTGGCGGGTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039654.1-935s21c1
Sequence:CCGGGATGCAGCTCAGAACTCATACCTCGAGGTATGAGTTCTGAGCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039654.1-219s21c1
Sequence:GTACCGGATCTTCAACCTCAAGTGATTCCTCGAGGAATCACTTGAGGTTGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039654.1-851s21c1
Sequence:CCGGGCAATAGAGCCCACCTAATTCCTCGAGGAATTAGGTGGGCTCTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039654.1-389s21c1
Sequence:CCGGGGGCATTACAAGAGTGGTTATCTCGAGATAACCACTCTTGTAATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039654
ZNF550 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 550
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039654.1-161s21c1
Sequence:CCGGCCACTTACCCGCCAGTCTTATCTCGAGATAAGACTGGCGGGTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039654.1-935s21c1
Sequence:CCGGGATGCAGCTCAGAACTCATACCTCGAGGTATGAGTTCTGAGCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039654.1-219s21c1
Sequence:GTACCGGATCTTCAACCTCAAGTGATTCCTCGAGGAATCACTTGAGGTTGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039654.1-851s21c1
Sequence:CCGGGCAATAGAGCCCACCTAATTCCTCGAGGAATTAGGTGGGCTCTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039654.1-389s21c1
Sequence:CCGGGGGCATTACAAGAGTGGTTATCTCGAGATAACCACTCTTGTAATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039654
ZNF550 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 550
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039654.1-161s21c1
Sequence:CCGGCCACTTACCCGCCAGTCTTATCTCGAGATAAGACTGGCGGGTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039654.1-935s21c1
Sequence:CCGGGATGCAGCTCAGAACTCATACCTCGAGGTATGAGTTCTGAGCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039654.1-219s21c1
Sequence:GTACCGGATCTTCAACCTCAAGTGATTCCTCGAGGAATCACTTGAGGTTGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039654.1-851s21c1
Sequence:CCGGGCAATAGAGCCCACCTAATTCCTCGAGGAATTAGGTGGGCTCTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039654.1-389s21c1
Sequence:CCGGGGGCATTACAAGAGTGGTTATCTCGAGATAACCACTCTTGTAATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks