EMAIL THIS PAGE TO A FRIEND

ZNF551

zinc finger protein 551

UniProtKB ID: Q7Z340, B4DU22, P17034, Q8N246, Q9BRY1
Gene ID:
naked mole-rat(101697085) zinc finger protein 551
Horse(100062079) zinc finger protein 551
dog(491461) zinc finger protein 551
domestic cat(101092972) zinc finger protein 551
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138347 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138347 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217627 predicted 355
2 SASI_Hs02_00363436 predicted 1155
3 SASI_Hs01_00217630 predicted 401
4 SASI_Hs01_00217631 predicted 2204
5 SASI_Hs01_00217632 predicted 375
6 SASI_Hs01_00217633 predicted 971
7 SASI_Hs01_00217634 predicted 300
8 SASI_Hs02_00363437 predicted 1584
9 SASI_Hs02_00363438 predicted 342
10 SASI_Hs02_00363439 predicted 1566
11 SASI_Hs01_00217626 predicted 1487
12 SASI_Hs01_00217628 predicted 1006
13 SASI_Hs01_00217629 predicted 1579
14 SASI_Hs01_00217635 predicted 823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138347
VALIDATED
ZNF551 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 551
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_138347.3-795s21c1
Sequence:CCGGGTAGCAGCAGCAAGCATATACCTCGAGGTATATGCTTGCTGCTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_138347.3-2244s21c1
Sequence:GTACCGGTGGTAGCCATCTTCGTAAATTCTCGAGAATTTACGAAGATGGCTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138347.3-1618s21c1
Sequence:GTACCGGGAAATCCTTTAGCCGCAAATTCTCGAGAATTTGCGGCTAAAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138347.3-1384s21c1
Sequence:GTACCGGCTTCAATCTCATTCGACATAGCTCGAGCTATGTCGAATGAGATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_138347.3-1749s21c1
Sequence:CCGGATACTGGCACAAGACCTTATGCTCGAGCATAAGGTCTTGTGCCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138347.2-1583s1c1
Sequence:CCGGCGCAAATTTATCCTGATTCAACTCGAGTTGAATCAGGATAAATTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138347.2-753s1c1
Sequence:CCGGGCAGCAAGCATATACAGGCATCTCGAGATGCCTGTATATGCTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_138347.2-2087s1c1
Sequence:CCGGCGCAAATCTAACCTCATTCGACTCGAGTCGAATGAGGTTAGATTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138347.2-328s1c1
Sequence:CCGGCCTGGGTTATTGCCATGGAATCTCGAGATTCCATGGCAATAACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138347.2-1003s1c1
Sequence:CCGGCCACCTAATCTTACACAAGATCTCGAGATCTTGTGTAAGATTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138347
VALIDATED
ZNF551 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 551
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_138347.3-795s21c1
Sequence:CCGGGTAGCAGCAGCAAGCATATACCTCGAGGTATATGCTTGCTGCTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_138347.3-2244s21c1
Sequence:GTACCGGTGGTAGCCATCTTCGTAAATTCTCGAGAATTTACGAAGATGGCTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138347.3-1618s21c1
Sequence:GTACCGGGAAATCCTTTAGCCGCAAATTCTCGAGAATTTGCGGCTAAAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138347.3-1384s21c1
Sequence:GTACCGGCTTCAATCTCATTCGACATAGCTCGAGCTATGTCGAATGAGATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_138347.3-1749s21c1
Sequence:CCGGATACTGGCACAAGACCTTATGCTCGAGCATAAGGTCTTGTGCCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138347.2-1583s1c1
Sequence:CCGGCGCAAATTTATCCTGATTCAACTCGAGTTGAATCAGGATAAATTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138347.2-753s1c1
Sequence:CCGGGCAGCAAGCATATACAGGCATCTCGAGATGCCTGTATATGCTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_138347.2-2087s1c1
Sequence:CCGGCGCAAATCTAACCTCATTCGACTCGAGTCGAATGAGGTTAGATTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138347.2-328s1c1
Sequence:CCGGCCTGGGTTATTGCCATGGAATCTCGAGATTCCATGGCAATAACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138347.2-1003s1c1
Sequence:CCGGCCACCTAATCTTACACAAGATCTCGAGATCTTGTGTAAGATTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138347
VALIDATED
ZNF551 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 551
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_138347.3-795s21c1
Sequence:CCGGGTAGCAGCAGCAAGCATATACCTCGAGGTATATGCTTGCTGCTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_138347.3-2244s21c1
Sequence:GTACCGGTGGTAGCCATCTTCGTAAATTCTCGAGAATTTACGAAGATGGCTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138347.3-1618s21c1
Sequence:GTACCGGGAAATCCTTTAGCCGCAAATTCTCGAGAATTTGCGGCTAAAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138347.3-1384s21c1
Sequence:GTACCGGCTTCAATCTCATTCGACATAGCTCGAGCTATGTCGAATGAGATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_138347.3-1749s21c1
Sequence:CCGGATACTGGCACAAGACCTTATGCTCGAGCATAAGGTCTTGTGCCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138347.2-1583s1c1
Sequence:CCGGCGCAAATTTATCCTGATTCAACTCGAGTTGAATCAGGATAAATTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138347.2-753s1c1
Sequence:CCGGGCAGCAAGCATATACAGGCATCTCGAGATGCCTGTATATGCTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_138347.2-2087s1c1
Sequence:CCGGCGCAAATCTAACCTCATTCGACTCGAGTCGAATGAGGTTAGATTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138347.2-328s1c1
Sequence:CCGGCCTGGGTTATTGCCATGGAATCTCGAGATTCCATGGCAATAACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138347.2-1003s1c1
Sequence:CCGGCCACCTAATCTTACACAAGATCTCGAGATCTTGTGTAAGATTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks