EMAIL THIS PAGE TO A FRIEND

ZNF552

zinc finger protein 552

Species: Human ZNF552(79818)
UniProtKB ID: Q9H707, B3KUE9, Q6P5A6
Gene ID:
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024762 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024762 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078512 predicted 967
2 SASI_Hs01_00078513 predicted 975
3 SASI_Hs01_00078515 predicted 794
4 SASI_Hs01_00078516 predicted 927
5 SASI_Hs01_00078517 predicted 1003
6 SASI_Hs01_00078518 predicted 911
7 SASI_Hs01_00078520 predicted 1439
8 SASI_Hs01_00078521 predicted 1429
9 SASI_Hs02_00357264 predicted 1406
10 SASI_Hs01_00078514 predicted 1055
11 SASI_Hs01_00078519 predicted 1090
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024762
ZNF552 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 552
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024762.2-489s1c1
Sequence:CCGGGCAGATCATCAGGGAACACATCTCGAGATGTGTTCCCTGATGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024762.2-1061s1c1
Sequence:CCGGGTGTGAGGTTTGTCAGAAATTCTCGAGAATTTCTGACAAACCTCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024762.2-576s1c1
Sequence:CCGGCAGCACCAGAATGAGCACATTCTCGAGAATGTGCTCATTCTGGTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024762.2-363s1c1
Sequence:CCGGCCTTCTAAGCAGAGTATTTATCTCGAGATAAATACTCTGCTTAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024762.2-1177s1c1
Sequence:CCGGGCTCTACATTCCGTGTTCATACTCGAGTATGAACACGGAATGTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024762.3-1399s21c1
Sequence:CCGGAGTGAGTCCAGTCTCATTAAACTCGAGTTTAATGAGACTGGACTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024762
ZNF552 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 552
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024762.2-489s1c1
Sequence:CCGGGCAGATCATCAGGGAACACATCTCGAGATGTGTTCCCTGATGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024762.2-1061s1c1
Sequence:CCGGGTGTGAGGTTTGTCAGAAATTCTCGAGAATTTCTGACAAACCTCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024762.2-576s1c1
Sequence:CCGGCAGCACCAGAATGAGCACATTCTCGAGAATGTGCTCATTCTGGTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024762.2-363s1c1
Sequence:CCGGCCTTCTAAGCAGAGTATTTATCTCGAGATAAATACTCTGCTTAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024762.2-1177s1c1
Sequence:CCGGGCTCTACATTCCGTGTTCATACTCGAGTATGAACACGGAATGTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024762.3-1399s21c1
Sequence:CCGGAGTGAGTCCAGTCTCATTAAACTCGAGTTTAATGAGACTGGACTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024762
ZNF552 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 552
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024762.2-489s1c1
Sequence:CCGGGCAGATCATCAGGGAACACATCTCGAGATGTGTTCCCTGATGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024762.2-1061s1c1
Sequence:CCGGGTGTGAGGTTTGTCAGAAATTCTCGAGAATTTCTGACAAACCTCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024762.2-576s1c1
Sequence:CCGGCAGCACCAGAATGAGCACATTCTCGAGAATGTGCTCATTCTGGTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024762.2-363s1c1
Sequence:CCGGCCTTCTAAGCAGAGTATTTATCTCGAGATAAATACTCTGCTTAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024762.2-1177s1c1
Sequence:CCGGGCTCTACATTCCGTGTTCATACTCGAGTATGAACACGGAATGTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024762.3-1399s21c1
Sequence:CCGGAGTGAGTCCAGTCTCATTAAACTCGAGTTTAATGAGACTGGACTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks