EMAIL THIS PAGE TO A FRIEND

ZNF554

zinc finger protein 554

UniProtKB ID: Q86TJ5, Q8NAT3, Q9BWN3
Gene ID:
dog(100686725) zinc finger protein 554
cow(100125579) zinc finger protein 554
sheep(101119043) zinc finger protein 554
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001102651 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001102651 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001102651 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152303 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024961 MISSION® esiRNA esiRNA human ZNF554 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102651 Rosetta Predictions human pricing
NM_152303 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323430 predicted 1189
2 SASI_Hs02_00323431 predicted 636
3 SASI_Hs02_00323432 predicted 1449
4 SASI_Hs02_00323433 predicted 657
5 SASI_Hs02_00323434 predicted 907
6 SASI_Hs02_00323435 predicted 1102
7 SASI_Hs02_00323436 predicted 502
8 SASI_Hs02_00323437 predicted 915
9 SASI_Hs02_00323438 predicted 673
10 SASI_Hs02_00323439 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205391 predicted 1245
2 SASI_Hs01_00205392 predicted 697
3 SASI_Hs01_00205393 predicted 813
4 SASI_Hs01_00205394 predicted 1510
5 SASI_Hs01_00205395 predicted 718
6 SASI_Hs01_00205396 predicted 962
7 SASI_Hs01_00205397 predicted 1154
8 SASI_Hs01_00205398 predicted 1088
9 SASI_Hs01_00205399 predicted 978
10 SASI_Hs01_00205400 predicted 728
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102651
ZNF554 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 554
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102651.1-2678s21c1
Sequence:CCGGCAAGAACCATCACGTGTTAATCTCGAGATTAACACGTGATGGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102651.1-1044s21c1
Sequence:CCGGCCGCCAGAACAGTCACTTTATCTCGAGATAAAGTGACTGTTCTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102651.1-1785s21c1
Sequence:CCGGCTACCAGAACAGACATCTTATCTCGAGATAAGATGTCTGTTCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102651.1-702s21c1
Sequence:CCGGGGAACCAGCCAGTGGTATAAACTCGAGTTTATACCACTGGCTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102651.1-315s21c1
Sequence:CCGGCTGGTCCCAGGAATTAGTAACCTCGAGGTTACTAATTCCTGGGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102651
ZNF554 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 554
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102651.1-2678s21c1
Sequence:CCGGCAAGAACCATCACGTGTTAATCTCGAGATTAACACGTGATGGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102651.1-1044s21c1
Sequence:CCGGCCGCCAGAACAGTCACTTTATCTCGAGATAAAGTGACTGTTCTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102651.1-1785s21c1
Sequence:CCGGCTACCAGAACAGACATCTTATCTCGAGATAAGATGTCTGTTCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102651.1-702s21c1
Sequence:CCGGGGAACCAGCCAGTGGTATAAACTCGAGTTTATACCACTGGCTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102651.1-315s21c1
Sequence:CCGGCTGGTCCCAGGAATTAGTAACCTCGAGGTTACTAATTCCTGGGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102651
ZNF554 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 554
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102651.1-2678s21c1
Sequence:CCGGCAAGAACCATCACGTGTTAATCTCGAGATTAACACGTGATGGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102651.1-1044s21c1
Sequence:CCGGCCGCCAGAACAGTCACTTTATCTCGAGATAAAGTGACTGTTCTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102651.1-1785s21c1
Sequence:CCGGCTACCAGAACAGACATCTTATCTCGAGATAAGATGTCTGTTCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102651.1-702s21c1
Sequence:CCGGGGAACCAGCCAGTGGTATAAACTCGAGTTTATACCACTGGCTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102651.1-315s21c1
Sequence:CCGGCTGGTCCCAGGAATTAGTAACCTCGAGGTTACTAATTCCTGGGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152303
ZNF554 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 554
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152303.1-1156s1c1
Sequence:CCGGGCAGTCATTGAACCACGGTATCTCGAGATACCGTGGTTCAATGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152303.1-761s1c1
Sequence:CCGGGCCAGTGGTATAAATATGATACTCGAGTATCATATTTATACCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152303.1-1178s1c1
Sequence:CCGGGCCCTGACTATCCACAACAAACTCGAGTTTGTTGTGGATAGTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152303.1-987s1c1
Sequence:CCGGGCAGCGAGTTAGATATTACAACTCGAGTTGTAATATCTAACTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152303.1-1832s1c1
Sequence:CCGGGCGTTCTACCAGAACAGACATCTCGAGATGTCTGTTCTGGTAGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152303
ZNF554 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 554
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152303.1-1156s1c1
Sequence:CCGGGCAGTCATTGAACCACGGTATCTCGAGATACCGTGGTTCAATGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152303.1-761s1c1
Sequence:CCGGGCCAGTGGTATAAATATGATACTCGAGTATCATATTTATACCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152303.1-1178s1c1
Sequence:CCGGGCCCTGACTATCCACAACAAACTCGAGTTTGTTGTGGATAGTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152303.1-987s1c1
Sequence:CCGGGCAGCGAGTTAGATATTACAACTCGAGTTGTAATATCTAACTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152303.1-1832s1c1
Sequence:CCGGGCGTTCTACCAGAACAGACATCTCGAGATGTCTGTTCTGGTAGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152303
ZNF554 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 554
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152303.1-1156s1c1
Sequence:CCGGGCAGTCATTGAACCACGGTATCTCGAGATACCGTGGTTCAATGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152303.1-761s1c1
Sequence:CCGGGCCAGTGGTATAAATATGATACTCGAGTATCATATTTATACCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152303.1-1178s1c1
Sequence:CCGGGCCCTGACTATCCACAACAAACTCGAGTTTGTTGTGGATAGTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152303.1-987s1c1
Sequence:CCGGGCAGCGAGTTAGATATTACAACTCGAGTTGTAATATCTAACTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152303.1-1832s1c1
Sequence:CCGGGCGTTCTACCAGAACAGACATCTCGAGATGTCTGTTCTGGTAGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks