EMAIL THIS PAGE TO A FRIEND

ZNF555

zinc finger protein 555

UniProtKB ID: Q8NEP9, A8KA89, K7EQM2, Q8NA46, Q96MP1
Gene ID:
cow(538773) zinc finger protein 555
sheep(101119303) zinc finger protein 555
naked mole-rat(101726002) zinc finger protein 555
chicken(426408) zinc finger protein 555
dog(100686649) zinc finger protein 555
domestic cat(101084005) zinc finger protein 555
Horse(100060239) zinc finger protein 555
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152791 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121631 MISSION® esiRNA esiRNA human ZNF555 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152791 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110490 predicted 891
2 SASI_Hs01_00110491 predicted 948
3 SASI_Hs01_00110492 predicted 509
4 SASI_Hs01_00110493 predicted 1796
5 SASI_Hs02_00366739 predicted 1501
6 SASI_Hs01_00110494 predicted 1735
7 SASI_Hs01_00110495 predicted 213
8 SASI_Hs01_00110496 predicted 679
9 SASI_Hs02_00366740 predicted 626
10 SASI_Hs01_00110497 predicted 462
11 SASI_Hs01_00110498 predicted 1807
12 SASI_Hs01_00110499 predicted 885
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152791
ZNF555 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 555
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152791.3-1512s1c1
Sequence:CCGGCCTGAAGACAAATCCTATGAACTCGAGTTCATAGGATTTGTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152791.3-303s1c1
Sequence:CCGGGCCACGTTCACCAGAAATGTTCTCGAGAACATTTCTGGTGAACGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152791.3-1731s1c1
Sequence:CCGGCCATCATCTTTACCAATACATCTCGAGATGTATTGGTAAAGATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152791.3-1048s1c1
Sequence:CCGGCCTTCAGTTATTCTTCGGCTTCTCGAGAAGCCGAAGAATAACTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152791.3-899s21c1
Sequence:CCGGGTTTCGAAGACACACAATAACCTCGAGGTTATTGTGTGTCTTCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152791.3-1807s21c1
Sequence:CCGGTCAATTGTTCCTCATCCTTAACTCGAGTTAAGGATGAGGAACAATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152791.3-462s21c1
Sequence:CCGGAGCCAGATTCCACATCTTAATCTCGAGATTAAGATGTGGAATCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152791
ZNF555 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 555
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152791.3-1512s1c1
Sequence:CCGGCCTGAAGACAAATCCTATGAACTCGAGTTCATAGGATTTGTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152791.3-303s1c1
Sequence:CCGGGCCACGTTCACCAGAAATGTTCTCGAGAACATTTCTGGTGAACGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152791.3-1731s1c1
Sequence:CCGGCCATCATCTTTACCAATACATCTCGAGATGTATTGGTAAAGATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152791.3-1048s1c1
Sequence:CCGGCCTTCAGTTATTCTTCGGCTTCTCGAGAAGCCGAAGAATAACTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152791.3-899s21c1
Sequence:CCGGGTTTCGAAGACACACAATAACCTCGAGGTTATTGTGTGTCTTCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152791.3-1807s21c1
Sequence:CCGGTCAATTGTTCCTCATCCTTAACTCGAGTTAAGGATGAGGAACAATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152791.3-462s21c1
Sequence:CCGGAGCCAGATTCCACATCTTAATCTCGAGATTAAGATGTGGAATCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152791
ZNF555 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 555
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152791.3-1512s1c1
Sequence:CCGGCCTGAAGACAAATCCTATGAACTCGAGTTCATAGGATTTGTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152791.3-303s1c1
Sequence:CCGGGCCACGTTCACCAGAAATGTTCTCGAGAACATTTCTGGTGAACGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152791.3-1731s1c1
Sequence:CCGGCCATCATCTTTACCAATACATCTCGAGATGTATTGGTAAAGATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152791.3-1048s1c1
Sequence:CCGGCCTTCAGTTATTCTTCGGCTTCTCGAGAAGCCGAAGAATAACTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152791.3-899s21c1
Sequence:CCGGGTTTCGAAGACACACAATAACCTCGAGGTTATTGTGTGTCTTCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152791.3-1807s21c1
Sequence:CCGGTCAATTGTTCCTCATCCTTAACTCGAGTTAAGGATGAGGAACAATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152791.3-462s21c1
Sequence:CCGGAGCCAGATTCCACATCTTAATCTCGAGATTAAGATGTGGAATCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks