EMAIL THIS PAGE TO A FRIEND

ZNF556

zinc finger protein 556

UniProtKB ID: Q9HAH1, Q96GM3
Gene ID:
domestic cat(101084263) zinc finger protein 556
dog(100686572) zinc finger protein 556
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024967 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024967 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024967 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109961 MISSION® esiRNA esiRNA human ZNF556 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024967 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187796 predicted 392
2 SASI_Hs01_00187799 predicted 1176
3 SASI_Hs01_00187800 predicted 208
4 SASI_Hs01_00187801 predicted 1191
5 SASI_Hs01_00187802 predicted 458
6 SASI_Hs01_00187803 predicted 1189
7 SASI_Hs01_00187804 predicted 345
8 SASI_Hs01_00187805 predicted 431
9 SASI_Hs02_00357632 predicted 640
10 SASI_Hs02_00357633 predicted 1216
11 SASI_Hs01_00187797 predicted 821
12 SASI_Hs01_00187798 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024967
ZNF556 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 556
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024967.1-900s21c1
Sequence:CCGGGAAATCCTTTCGAGTCCATATCTCGAGATATGGACTCGAAAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024967.1-1180s21c1
Sequence:CCGGACTAGAGAGAAAGTCTATAAACTCGAGTTTATAGACTTTCTCTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024967.1-349s21c1
Sequence:CCGGTGGGAAGAACATAGCGTTAAACTCGAGTTTAACGCTATGTTCTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024967.1-1346s21c1
Sequence:CCGGTTGGACAGAAGCCCAGTAAATCTCGAGATTTACTGGGCTTCTGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024967.1-557s1c1
Sequence:CCGGCCCATTCCTCATCCCTGATAACTCGAGTTATCAGGGATGAGGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024967.1-1238s1c1
Sequence:CCGGCTTTACACAAACATGAGAGAACTCGAGTTCTCTCATGTTTGTGTAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024967.1-214s1c1
Sequence:CCGGGTAGATAATGAGGCTCAGCTTCTCGAGAAGCTGAGCCTCATTATCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024967.1-1403s1c1
Sequence:CCGGCCTTTCAAGGTCATGTGAGAACTCGAGTTCTCACATGACCTTGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024967
ZNF556 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 556
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024967.1-900s21c1
Sequence:CCGGGAAATCCTTTCGAGTCCATATCTCGAGATATGGACTCGAAAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024967.1-1180s21c1
Sequence:CCGGACTAGAGAGAAAGTCTATAAACTCGAGTTTATAGACTTTCTCTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024967.1-349s21c1
Sequence:CCGGTGGGAAGAACATAGCGTTAAACTCGAGTTTAACGCTATGTTCTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024967.1-1346s21c1
Sequence:CCGGTTGGACAGAAGCCCAGTAAATCTCGAGATTTACTGGGCTTCTGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024967.1-557s1c1
Sequence:CCGGCCCATTCCTCATCCCTGATAACTCGAGTTATCAGGGATGAGGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024967.1-1238s1c1
Sequence:CCGGCTTTACACAAACATGAGAGAACTCGAGTTCTCTCATGTTTGTGTAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024967.1-214s1c1
Sequence:CCGGGTAGATAATGAGGCTCAGCTTCTCGAGAAGCTGAGCCTCATTATCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024967.1-1403s1c1
Sequence:CCGGCCTTTCAAGGTCATGTGAGAACTCGAGTTCTCACATGACCTTGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024967
ZNF556 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 556
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024967.1-900s21c1
Sequence:CCGGGAAATCCTTTCGAGTCCATATCTCGAGATATGGACTCGAAAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024967.1-1180s21c1
Sequence:CCGGACTAGAGAGAAAGTCTATAAACTCGAGTTTATAGACTTTCTCTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024967.1-349s21c1
Sequence:CCGGTGGGAAGAACATAGCGTTAAACTCGAGTTTAACGCTATGTTCTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024967.1-1346s21c1
Sequence:CCGGTTGGACAGAAGCCCAGTAAATCTCGAGATTTACTGGGCTTCTGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024967.1-557s1c1
Sequence:CCGGCCCATTCCTCATCCCTGATAACTCGAGTTATCAGGGATGAGGAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024967.1-1238s1c1
Sequence:CCGGCTTTACACAAACATGAGAGAACTCGAGTTCTCTCATGTTTGTGTAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024967.1-214s1c1
Sequence:CCGGGTAGATAATGAGGCTCAGCTTCTCGAGAAGCTGAGCCTCATTATCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024967.1-1403s1c1
Sequence:CCGGCCTTTCAAGGTCATGTGAGAACTCGAGTTCTCACATGACCTTGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks